ID: 1019907370

View in Genome Browser
Species Human (GRCh38)
Location 7:4074991-4075013
Sequence CCTCCCAGGGAGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 782
Summary {0: 1, 1: 0, 2: 11, 3: 85, 4: 685}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019907370_1019907379 -6 Left 1019907370 7:4074991-4075013 CCTTCTCCCCTCTCCCTGGGAGG 0: 1
1: 0
2: 11
3: 85
4: 685
Right 1019907379 7:4075008-4075030 GGGAGGAGGAAAAGGAGACCAGG 0: 1
1: 0
2: 11
3: 122
4: 1351
1019907370_1019907381 12 Left 1019907370 7:4074991-4075013 CCTTCTCCCCTCTCCCTGGGAGG 0: 1
1: 0
2: 11
3: 85
4: 685
Right 1019907381 7:4075026-4075048 CCAGGACCTGAGAAGCAGCCAGG 0: 1
1: 0
2: 7
3: 63
4: 734

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019907370 Original CRISPR CCTCCCAGGGAGAGGGGAGA AGG (reversed) Intronic
900321368 1:2085828-2085850 CCTGCCTGTGAGAGGGGAGCCGG - Intronic
900473203 1:2864461-2864483 CCCCCCAGGGTGAGGGGCAATGG - Intergenic
900618286 1:3575332-3575354 CCTCCCAGGGACAGGGGAGGGGG + Intronic
900652407 1:3736350-3736372 CCTCCGAGGCACAGGGCAGAGGG - Intergenic
900701032 1:4048717-4048739 CCTGCCATGGGGAGGGGAGTGGG - Intergenic
900793795 1:4695486-4695508 GCTCCAGGGGAGAGTGGAGATGG + Intronic
900816258 1:4848660-4848682 CTTCACAGGGAGAGGGGAGATGG + Intergenic
900970442 1:5989762-5989784 ACACCCAGGGAGAGGGCAGGAGG - Intronic
901063312 1:6483842-6483864 GCTCCCAGGAAGAGGGGACAAGG - Intronic
901260414 1:7866627-7866649 GCTCCCAGGGAGGGAGGAGGGGG - Intergenic
901602462 1:10432623-10432645 CCAGCCAGGGGGAGGGGAGGAGG + Intronic
901694605 1:10997498-10997520 CCTAGGAGGGGGAGGGGAGAGGG + Intergenic
901927984 1:12579073-12579095 CCTGCGAGGGAGAGGGCCGAGGG + Intronic
902153783 1:14466487-14466509 CCTCTCAGGGAGTGGGGTGAGGG + Intergenic
902335314 1:15751163-15751185 CCCACCAGGGAGAGGGGTGGAGG + Intergenic
902380558 1:16050449-16050471 CATCCCAAGGAGAGGGAAGCAGG - Intronic
902919597 1:19657981-19658003 CATCCCTGGGAGAGGGGAGAAGG - Exonic
903132508 1:21289431-21289453 CCTCCCCAGGAGTGGGCAGATGG + Intronic
903221291 1:21870964-21870986 CCCAGAAGGGAGAGGGGAGAAGG + Intronic
903320054 1:22537672-22537694 GCTCCCAGAGAGTGGGCAGAGGG + Intergenic
903953903 1:27012135-27012157 CCTGGCTGGGAGAGGGGAGGAGG - Intronic
904044126 1:27600176-27600198 CCCCCCAGGGAGGGGGGCGGGGG - Intronic
904049677 1:27631762-27631784 GTTCCCAGGGTGAGGTGAGAGGG + Intronic
904268358 1:29331225-29331247 CATCCCAGGGAGAGAGTAGGAGG - Intergenic
904303970 1:29575161-29575183 CCTGTCAGGCAGAGGGGAGTGGG + Intergenic
904470591 1:30733714-30733736 CCTGCCAGGGAGGGGCGGGAGGG + Exonic
904478987 1:30782534-30782556 CCCGCCCTGGAGAGGGGAGACGG + Intergenic
904481018 1:30793463-30793485 CTTGCCAGGGAGAGAGGGGAAGG - Intergenic
904492967 1:30871634-30871656 CCTGCCAGGCAGAGGGCAGAGGG + Intronic
904892123 1:33787405-33787427 AGGCCCAGGGAGCGGGGAGAAGG - Intronic
905013439 1:34761960-34761982 CCTCCCTGGGAGAGGACATATGG - Exonic
905339089 1:37266140-37266162 CCTCCCAGGCAGAGGGGCTTGGG - Intergenic
905446238 1:38030058-38030080 CCTCAAAGGGAGTGAGGAGATGG - Intergenic
905695342 1:39969483-39969505 CCTGCAAGAGAGAGAGGAGATGG - Exonic
906141016 1:43533477-43533499 CCTCCCTGGGGGCGGGGAGGAGG + Intronic
906359245 1:45138703-45138725 TCTCCCCTGGGGAGGGGAGAGGG - Intronic
906516333 1:46440919-46440941 CTTCCCAGGGACAGAGGTGAAGG - Intergenic
906607278 1:47181236-47181258 CCTCCCAGGGCCTGGGGAGGGGG - Intergenic
906669443 1:47643868-47643890 CTTCCAAGGGAGAGGGCAGGGGG + Intergenic
906892653 1:49734264-49734286 AGTGCCATGGAGAGGGGAGAGGG + Intronic
907285373 1:53376427-53376449 CCTTCCATGGACAGGGGTGAAGG + Intergenic
907339951 1:53727710-53727732 CTTCCCAGAGGGAGGGGAGAGGG + Intronic
907527825 1:55063975-55063997 CTTCCCATGGATAGGGGAGGGGG + Exonic
908769424 1:67582831-67582853 TCTCCCAGTGAGAGGGGAGGTGG - Intergenic
908787418 1:67749024-67749046 CCTCCAGGGGAGTGGGAAGAGGG - Intronic
909243175 1:73240504-73240526 CCTGCCAGGGGGTGGGGAGAGGG + Intergenic
910262215 1:85303734-85303756 CATCCCAGGGTGAGGGGAACTGG + Intergenic
910333312 1:86100709-86100731 CCTCCCTGGCAGAGGGGGTAGGG - Intronic
910333322 1:86100719-86100741 TCTGCCAGGGAGGGGAGAGAGGG + Intronic
910494993 1:87816822-87816844 GGTCCCAGGGAGAGTGGAGAGGG + Intergenic
911120748 1:94293903-94293925 TCTAACTGGGAGAGGGGAGAGGG - Intergenic
911415811 1:97571966-97571988 TCTCCAAGTGAGAGGGGAGCTGG - Intronic
912412517 1:109488586-109488608 CCACCCAAGGGAAGGGGAGATGG + Intronic
912725668 1:112057143-112057165 CCTCCCGGGGAGAGGGGAGGTGG - Intergenic
912953376 1:114135800-114135822 CCACCCAGGGAGAGGGGTGAGGG - Intronic
914753297 1:150549803-150549825 CCTCCTAGAGAGAGGGCAGGAGG - Exonic
914754810 1:150556722-150556744 CCTCCCAGGGAGGAGGGCAAAGG + Exonic
915138705 1:153752672-153752694 GCTGCCAGGAAGAGGGGAGGAGG - Intronic
915267945 1:154732146-154732168 CCTCCAGGGGAAAGTGGAGATGG - Intronic
915288523 1:154867955-154867977 CCTCCCAGAGGGAGTGGAGATGG - Intronic
916067269 1:161146386-161146408 AATCCCAGGGGGAGGGGGGAGGG - Intergenic
916423561 1:164659664-164659686 GCTGCCAGGGAGAGGGAACAAGG - Intronic
916737550 1:167621491-167621513 CATCTCAGGGGGCGGGGAGAGGG + Intergenic
917681499 1:177372746-177372768 ACACCCAGAGAGAGGGGAGTGGG + Intergenic
917821470 1:178768386-178768408 CCCCCTAGGGAGTGGGGAAAGGG - Intronic
918207727 1:182324359-182324381 AGTCCCAGGGAGAAGGGAAAGGG + Intergenic
919755878 1:201066111-201066133 CTGCCCAGGGAGATGGGACAGGG + Intronic
919831803 1:201546393-201546415 GTTCCCAGGGGGAGGGGAAAGGG + Intergenic
919991275 1:202709898-202709920 CGTCCCAGGGAAAGGAGAGAGGG + Intronic
920112805 1:203598945-203598967 CCTCCCCAGCTGAGGGGAGAGGG + Intergenic
920176849 1:204107490-204107512 CATCCCAGGGAGGGGAGCGACGG - Intronic
920214247 1:204350904-204350926 CCCACGAGGGAGAGAGGAGAGGG + Intronic
920535481 1:206734057-206734079 CCTCCAAGGGAAGGGGGAGTGGG - Exonic
920679413 1:208060897-208060919 CCTCCCTGGGGGAGGGGGAAGGG - Intronic
921189009 1:212693514-212693536 CCCCACAGAGAGAGAGGAGAAGG + Intronic
921515302 1:216084090-216084112 CCACCCAGGGGAAGGGGAGAGGG - Intronic
922137712 1:222847730-222847752 CAACCCAGGGGGAAGGGAGAAGG + Intergenic
922465005 1:225840377-225840399 GCTGCAGGGGAGAGGGGAGAGGG + Intronic
922537025 1:226388989-226389011 CCAGCCAGGGAGAGGGGCTAGGG + Intronic
922802069 1:228368968-228368990 CCTCCCCGGGGCAGAGGAGAGGG - Intronic
923017780 1:230140168-230140190 CCTCTCAGGCAGAGGTGAGCTGG - Intronic
923305708 1:232686346-232686368 CCTACCAGGGAGGGTGCAGACGG - Intergenic
923994053 1:239471635-239471657 CCTCAGTGGGAGAGGAGAGAAGG - Intronic
924539907 1:244970778-244970800 CCTCCGAGGGAGGGGGAAGGAGG - Exonic
1063096178 10:2911109-2911131 CCTCCCAGGGGGAGAGGACAAGG - Intergenic
1063537685 10:6901012-6901034 CCTTCCATGGAGAGGAGACATGG + Intergenic
1064884889 10:20100593-20100615 CATATCAGGGAGAGAGGAGAAGG - Intronic
1065827148 10:29582921-29582943 TCGTCCAGGGAGAGCGGAGAAGG + Intronic
1065950705 10:30648247-30648269 TCATCCAGGGAGAGCGGAGAAGG - Intergenic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066427128 10:35317726-35317748 GCTCCCAGGGAAAGGGGACGTGG + Intronic
1066703867 10:38157030-38157052 CCTCCCAGGGAGTGGCGTGCAGG - Intergenic
1067139055 10:43640485-43640507 CCTACCACAGGGAGGGGAGAGGG + Intergenic
1069511741 10:69047744-69047766 TCACCTGGGGAGAGGGGAGAGGG - Intergenic
1069597000 10:69678612-69678634 CATCCCAGGCAGAGGGTAGGTGG + Intergenic
1069609608 10:69764019-69764041 CCTCCCAGGAGGAGGGAAGGTGG + Intergenic
1069800688 10:71079867-71079889 TCTGCCAGGCTGAGGGGAGAGGG - Intergenic
1070628224 10:78066303-78066325 CATCCCAGTGAGAGGCGGGAAGG + Intergenic
1070629059 10:78071441-78071463 GCAACCAGGCAGAGGGGAGAAGG - Intergenic
1070630435 10:78080936-78080958 CCCCACAGGCAGAGAGGAGAAGG + Intergenic
1070652232 10:78245698-78245720 GCTCCCTGGCAGAGGGAAGAAGG + Intergenic
1070845235 10:79516928-79516950 CTTCTCAGGGAAACGGGAGATGG - Intergenic
1070928563 10:80243380-80243402 CTTCTCAGGGAAAAGGGAGATGG + Intergenic
1071259745 10:83909099-83909121 TCTCCTAGAGAGAGGGGAGGGGG + Intergenic
1071406354 10:85337032-85337054 CCTCACAGAGGGAGGGAAGAAGG + Intergenic
1071483350 10:86080839-86080861 CCACCAAGGGACAGGGGACAGGG + Intronic
1071847459 10:89535468-89535490 CGTGTCAGGGAGAGGGAAGAGGG + Exonic
1072695345 10:97599249-97599271 CTGCCCAGGGAGAGGAGATAAGG + Intronic
1073009847 10:100350556-100350578 CCTCCCCTGGGGAGGAGAGAAGG + Intronic
1073048872 10:100655305-100655327 CAGCGCCGGGAGAGGGGAGAGGG - Intergenic
1073150444 10:101307738-101307760 ACTCCCAGAGAGAGGGGTGAGGG + Intergenic
1073150585 10:101308766-101308788 TCTCCCAGGGAGATGGGGGATGG - Intergenic
1073417055 10:103392929-103392951 CCTCCATGGGAGAAGGGAGAAGG + Intronic
1073468265 10:103707089-103707111 CCTGTCAGGGAGAGGGGTGAAGG - Intronic
1073629932 10:105138320-105138342 CCTCCCCGAGTGAGGAGAGATGG + Intronic
1073733201 10:106315641-106315663 CTTCCCAGGGAGAGGGAGGACGG + Intergenic
1074111709 10:110427342-110427364 CCCCCATGGGAGAGGGGACAAGG - Intergenic
1074254456 10:111786258-111786280 CCTCCTAGGGAAAGGGAAGGGGG + Intergenic
1074759785 10:116658486-116658508 GCTGCCAAGGAGAGGGCAGATGG + Intergenic
1074861106 10:117511284-117511306 ACTTCCAGGGAGATGGGAGGGGG + Intergenic
1075517848 10:123123306-123123328 CCTCCCACGGGGCGGGGAGAGGG + Intergenic
1075617717 10:123903605-123903627 CCTCTCAGGGATAGGGGAAGAGG + Intronic
1075885660 10:125896799-125896821 TCTCTCCTGGAGAGGGGAGAAGG + Intronic
1076195609 10:128515460-128515482 CCTCCAAGGGCTGGGGGAGATGG + Intergenic
1076440333 10:130477033-130477055 CTTCCCAGGTAGAGGGGCCACGG + Intergenic
1076793303 10:132787637-132787659 CCTCCGAGGGAGCGGGGCGCAGG - Intergenic
1076902759 10:133347917-133347939 CCTCCACAGGAGCGGGGAGAGGG - Intronic
1077366199 11:2162325-2162347 CCTGGCCAGGAGAGGGGAGATGG - Intergenic
1077377602 11:2212488-2212510 CCGCCCAGGGAGGGGGGTGGTGG + Intergenic
1077392919 11:2308264-2308286 CCTCTCAGGCAGTGGGGAGCGGG + Intronic
1077499568 11:2903065-2903087 CCTCCCGGGGAGGGGAGACAGGG - Intronic
1077542548 11:3154094-3154116 CCTCCCAGGGAGAGTGGATAAGG - Intronic
1077544742 11:3164518-3164540 CCTCCCGGGGAGCGGGGTGCAGG - Intronic
1077695983 11:4393377-4393399 CCTCCCAGGTAGGGGGCAGCCGG + Intronic
1079558402 11:21791016-21791038 CCTGCCAGGGGGTGGGGAGCTGG - Intergenic
1080076504 11:28156608-28156630 ATTCCCAGGGAGAAGGGAAAGGG + Intronic
1080387905 11:31820336-31820358 TCTGCCAGGGAGAGGCGAGGTGG - Intronic
1080424541 11:32143975-32143997 CCTCCCAGGGAGAGCAGAGATGG + Intergenic
1080601982 11:33829341-33829363 CCTCCCAAGGCGGGGGGAGGGGG + Intergenic
1080816424 11:35761990-35762012 CCTCCCAAGGAAAGGGAAAAGGG - Intronic
1080878419 11:36297595-36297617 CATCCCAGGGCAAGGGAAGAGGG - Intronic
1080886873 11:36376174-36376196 CCTGCTGGGGAGAGCGGAGAGGG - Intronic
1081551820 11:44120562-44120584 CCTGCCAGGGACGTGGGAGAAGG + Intronic
1081796207 11:45821789-45821811 CCTCCCAGGAAGTGGAGAGTCGG - Intergenic
1081930698 11:46868807-46868829 ACTCCCAGGGACAGGGGAGGAGG + Intronic
1081964673 11:47162262-47162284 GCTCCTAGGCTGAGGGGAGAAGG + Intronic
1083048956 11:59760013-59760035 CCTCCCAGGTACAGAGAAGAGGG - Intronic
1083195120 11:61081498-61081520 AATCCCAGGGAGCGGGGAGGAGG - Intergenic
1083201724 11:61124865-61124887 CCTCCCAGGAAGAAAGGAGAGGG + Intronic
1083687292 11:64384242-64384264 CCTCCTAGGCAGAGGGCAGGAGG + Intergenic
1083959499 11:66006753-66006775 GCCCCAAGGGAGAGGTGAGAAGG - Intergenic
1084128896 11:67118795-67118817 CCTCCCAGGGGGGTGGGGGAGGG + Intergenic
1084597008 11:70123060-70123082 CCTCCCAGGGCATGGAGAGAAGG - Intronic
1085179374 11:74520664-74520686 TGTGTCAGGGAGAGGGGAGAGGG + Intronic
1085280140 11:75324877-75324899 TCTCCCAGGGACAGGGGTGGGGG - Intronic
1085306401 11:75488415-75488437 AGTCCCAGGGAGAGGGGAGTGGG + Intronic
1085506445 11:77063533-77063555 TCTCCCAGGTAGAGGAGAAAGGG + Intergenic
1085625116 11:78065908-78065930 CCTCAACGGGAGAGGGAAGAAGG - Intronic
1085832529 11:79916735-79916757 CCTCTGAGGGAGAGGGAACACGG - Intergenic
1087609811 11:100420783-100420805 ACTTCCTGGGAGAGGGGAGAAGG + Intergenic
1088625765 11:111729308-111729330 CCACCCAGGGAGAGCTGTGATGG + Exonic
1089017024 11:115173569-115173591 CCTCCGAGTGAGAGAAGAGATGG - Exonic
1089366434 11:117923678-117923700 CCTGTCGGGGAGTGGGGAGACGG + Intronic
1090002695 11:122976591-122976613 CCTCCCAGGGGAAAAGGAGAGGG + Intergenic
1090509399 11:127358059-127358081 CACCCCTGGGGGAGGGGAGAGGG - Intergenic
1090616688 11:128521899-128521921 CCTCCCCGGGTGAGTGGCGACGG - Intronic
1090730108 11:129565126-129565148 CCTCCCAGGAGGAGGGGGCAGGG + Intergenic
1090941797 11:131393610-131393632 CCTCCCAGGGTGAACAGAGAGGG + Intronic
1090948066 11:131449071-131449093 GCTCCCAGGGAAGGGGAAGAAGG + Intronic
1091112246 11:132980662-132980684 CCACCGAGGGAGAATGGAGATGG - Intronic
1091389781 12:118961-118983 CCACCCAGGAATAGGTGAGAAGG - Intronic
1091730038 12:2873946-2873968 TCTTCCAGGGAAAGGGGTGAGGG - Intronic
1091763770 12:3104990-3105012 TCACCCTGGGAGAGGGGTGAGGG + Intronic
1092817763 12:12326198-12326220 CCTGCCATGATGAGGGGAGAAGG - Exonic
1093851077 12:24039080-24039102 CCTGCCAGGGATATGGGAAAGGG - Intergenic
1094117462 12:26932712-26932734 GCTCTCTGGGAGACGGGAGAGGG - Intronic
1094480170 12:30875166-30875188 CCTCCCAGGCAGGGAGGGGAGGG + Intergenic
1095898568 12:47305179-47305201 CCTCTAAGGGAGAATGGAGATGG + Intergenic
1096413161 12:51391561-51391583 CCTCCCGGGGAGAGGGTCGCGGG + Intronic
1096870102 12:54587821-54587843 GGCTCCAGGGAGAGGGGAGAGGG - Intronic
1097173966 12:57132258-57132280 CCTCCCTGGGAAAGAGGTGAGGG + Intronic
1097205335 12:57316301-57316323 TCTCCCAGGGATTGGGGATAAGG - Intronic
1097689856 12:62724526-62724548 CCTCAGAGGGAGAGGGTAGGTGG - Intronic
1097909113 12:64949990-64950012 ACTCCCTGAGAGAGGGGAAAAGG - Intergenic
1099989449 12:89708162-89708184 CCTCCCGGGGCGCGGGGAGAGGG + Intronic
1100123696 12:91397740-91397762 CATCCCATGGAGAAGGCAGAAGG + Intergenic
1100813801 12:98366138-98366160 CATCCCTGGGAGAGTGGAGAGGG + Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101866076 12:108520542-108520564 CCTCCCAGGGGGATGGGACACGG - Exonic
1101881673 12:108630048-108630070 CCTTCCAGGAAGAGGAGAGGTGG - Intronic
1102096678 12:110246761-110246783 TCTCCCTGGGGGAGGGGAGAAGG + Intergenic
1103919087 12:124390149-124390171 CCTCCCCTGCAGAGGGCAGAGGG - Intronic
1104384961 12:128342703-128342725 CTTCCCAGGGAGGGCAGAGAAGG + Intronic
1104460889 12:128954945-128954967 GGTCCCAGGAAGAGGGGACAGGG - Intronic
1104607560 12:130201124-130201146 CTTCACAATGAGAGGGGAGATGG - Intergenic
1104694328 12:130852085-130852107 CCACGCAGGGAGAACGGAGAAGG + Intergenic
1104736778 12:131139932-131139954 CCCCCCAAGGACAGGGCAGAGGG - Exonic
1104748012 12:131221920-131221942 CCTCGCTGGCAGAGGGCAGAGGG + Intergenic
1104801205 12:131556227-131556249 ACTCCCCAGGAGAGGGGAGAGGG + Intergenic
1104810172 12:131615738-131615760 CCTCCCTTGGAGAGGATAGACGG - Intergenic
1104811204 12:131621298-131621320 TCTCCCCGGGGCAGGGGAGAGGG + Intergenic
1104976872 12:132556060-132556082 GCTCCCAGGGAAAGTGCAGAAGG - Intronic
1105767821 13:23578994-23579016 CATCCCAGCCAGAGGGGATACGG - Intronic
1105827043 13:24132110-24132132 GTGCCCAGGGAGAAGGGAGAAGG - Intronic
1106269291 13:28138495-28138517 CCGCCCGGGGAGAAGGGGGAGGG - Exonic
1106290568 13:28357413-28357435 AGTGGCAGGGAGAGGGGAGAAGG + Intronic
1107274813 13:38666497-38666519 CATCATAGGGAGTGGGGAGAAGG - Intergenic
1107898580 13:44989775-44989797 CCGGCCAGGGAGTGGGTAGATGG - Intronic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1108676116 13:52739255-52739277 GCCCCCAGGGAGTGGGGAGTCGG + Intronic
1108783806 13:53869717-53869739 CTTCCCAGGGAGAGAAGCGAAGG - Intergenic
1109489561 13:63078181-63078203 GCTGCCAGGGGCAGGGGAGAGGG - Intergenic
1109538790 13:63745869-63745891 CCTGTCATGGAGTGGGGAGAGGG + Intergenic
1109545045 13:63833897-63833919 CCTGTCATGGAGTGGGGAGAGGG - Intergenic
1109561180 13:64052479-64052501 CCACCCAGGAAGAGGGGCCAGGG + Intergenic
1110098242 13:71559902-71559924 CCTCTCTGGAGGAGGGGAGAAGG - Exonic
1111931126 13:94514278-94514300 CCTCACAGAGAAAGGGGAGGTGG + Intergenic
1111932120 13:94523360-94523382 CCCCCCAGGGAAAGGCAAGAAGG - Intergenic
1112135761 13:96576071-96576093 CCTGCCAGGAATGGGGGAGAGGG + Intronic
1112751562 13:102588828-102588850 CCTCACAGGGGAAGGGGTGAGGG - Intergenic
1113478035 13:110599224-110599246 CATCCCAGGGAGAGGGTAGCTGG - Intergenic
1113499906 13:110765015-110765037 GGTCTCAGGGAGAGGGGAGTGGG + Intergenic
1113513201 13:110872153-110872175 CCCCGCAGGGAGAGGCGGGAGGG - Intergenic
1114491051 14:23102239-23102261 CCTCCCAGTGCGAGGACAGAAGG + Intergenic
1115490368 14:33952492-33952514 CCTCAGAGGCAGAGAGGAGAGGG - Intronic
1115679703 14:35722942-35722964 CATTCCAGGGAGAGGGGTGAGGG - Intronic
1116478318 14:45367030-45367052 TCTTCAAGGGAGAAGGGAGAAGG - Intergenic
1117046867 14:51821739-51821761 CATCCCAGGAGGTGGGGAGAGGG + Intergenic
1117105804 14:52395834-52395856 TCCCGGAGGGAGAGGGGAGAGGG - Intergenic
1118483873 14:66195789-66195811 CTTTCCATGGAGAGGGGACATGG + Intergenic
1118735819 14:68701285-68701307 CCTTCCAGGCAGAGGTGACAGGG - Intronic
1118759589 14:68871898-68871920 CCATTCATGGAGAGGGGAGAAGG - Intergenic
1118801285 14:69191888-69191910 TCTCCCAGGGAGAGGGTAAGGGG - Exonic
1118884505 14:69855084-69855106 CCTCCCACGGAGAGGGGAACTGG + Intronic
1119200051 14:72745663-72745685 CTTCCCAAGGAGAGGGGAGCAGG - Intronic
1119330172 14:73787407-73787429 CCTCCCAGGGCGGGGGGTGCAGG - Intronic
1119574085 14:75702708-75702730 CAGCCCAGGGAGAGGTGGGAGGG - Intronic
1119889275 14:78170533-78170555 CCTCCCAGAGAGAAAGGAAAAGG + Intergenic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1121630759 14:95420313-95420335 CCACCCAGGGAGAGAGAAAAGGG + Intronic
1121718017 14:96089910-96089932 GCTCCCCAGGACAGGGGAGAGGG + Exonic
1122049014 14:99042681-99042703 CCTGCCAGGCGGAGGGGAGGAGG + Intergenic
1122156548 14:99753546-99753568 CCTGCCAGGGAGGGAGTAGAGGG - Intronic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1122501082 14:102200075-102200097 AGTCCCAGGGAGCGGGAAGAGGG - Intronic
1122645383 14:103189987-103190009 GCTCCCAGGGGAAGGGGAGGCGG - Intergenic
1122649697 14:103219867-103219889 GCTCCCAGGGGAAGGGGAGGTGG + Intergenic
1122743629 14:103885704-103885726 CCTACCTGTGAGAGGGCAGAGGG + Intergenic
1122848852 14:104515804-104515826 CCTTCCAGGCACTGGGGAGAGGG + Intronic
1122878054 14:104677860-104677882 CCTCCCAAGGAGGAGGCAGATGG + Intergenic
1202872411 14_GL000225v1_random:177141-177163 TCTCTCTTGGAGAGGGGAGAAGG - Intergenic
1124216648 15:27812979-27813001 CCTCCTGGGGAGGGGGCAGAAGG - Intronic
1124479846 15:30068706-30068728 CCTCCCAGGGACTGGGGAGTAGG - Intergenic
1124843166 15:33263724-33263746 TCACCCAGGGAGAGAGGAGTAGG - Intergenic
1125421936 15:39512697-39512719 CCCTCCAGGGAGAGGAGAGTTGG - Intergenic
1125816119 15:42586249-42586271 CCTCCTAGGTAGAGTGGAAAAGG + Intronic
1126174958 15:45727686-45727708 CTTTCCAGGGATAGGGGAGAGGG + Intergenic
1126317257 15:47383375-47383397 CCTCCCATGACGAGGGAAGATGG + Intronic
1127359107 15:58229394-58229416 CCTACCAGGGAGGGGGGTGGGGG + Intronic
1127857038 15:62961478-62961500 CCACAAAGGGAAAGGGGAGAAGG + Intergenic
1128114238 15:65095283-65095305 CTTCCCAGGGACAGGGAAGGAGG - Intronic
1128519867 15:68368184-68368206 TCTCCCTGGGAGATGGGGGATGG - Intronic
1128704827 15:69831376-69831398 TCTTCCAGGGAGAAGGCAGAGGG - Intergenic
1128992384 15:72272133-72272155 CCCCGCAGGGAGAGAGGACACGG + Intronic
1129660590 15:77550807-77550829 CTGCCCAGGGAGAGGACAGAAGG + Intergenic
1129744219 15:78007091-78007113 CTTCCCAGGGAGATGAGCGATGG + Intronic
1129830872 15:78669158-78669180 CCTGGGAGGGAGAGGGGAGGAGG + Intronic
1129930475 15:79406438-79406460 CCTCCCAGTTAGAGTGGGGATGG - Intronic
1130256303 15:82327584-82327606 CCTGCCATGGAGAGGGCAGCTGG - Intergenic
1130598648 15:85262404-85262426 CCTGCCATGGAGAGGGCAGCTGG + Intergenic
1130661408 15:85833935-85833957 CCTCCCAGCTAGAAAGGAGAGGG + Intergenic
1130889822 15:88124302-88124324 TCTGCCTGGGAGAGGGGAGCAGG + Intronic
1131350361 15:91694073-91694095 CCCCCCAGTGAGAGAGGAAATGG + Intergenic
1131507129 15:93029018-93029040 CCTGCCAGGGAGGAGGGAGGAGG - Intergenic
1132079481 15:98852312-98852334 CCGCCCCGGGTGAGGGAAGAGGG + Intronic
1132587077 16:710249-710271 CCACCCAGGGAGGGGGCAGCAGG + Intronic
1132602056 16:777699-777721 CGTGCCAGGCAGAGGGGAGGTGG + Intronic
1132712092 16:1273472-1273494 CCTCCCAGTGTGAGGGAGGAAGG + Intergenic
1132746006 16:1436588-1436610 CCACACAGGGAGAGGGAGGAGGG + Intronic
1132815098 16:1822084-1822106 GCCCCGAGGGTGAGGGGAGAAGG - Intronic
1132867369 16:2100130-2100152 CCTCCCACGGAGTGGGAACATGG + Intronic
1132904938 16:2277754-2277776 CGTCCCAGGGATTGGGGAGATGG + Intronic
1132925049 16:2424871-2424893 CATCCCAGGGATCAGGGAGATGG - Intergenic
1132983105 16:2749320-2749342 CCTCCCAGGCAGCTGGGAGGTGG + Intergenic
1133288755 16:4704157-4704179 CTTCCCAGGATGATGGGAGAAGG + Intronic
1133979496 16:10622680-10622702 GCTCCCAGGGTGAGGGGTGGGGG - Intergenic
1134417757 16:14059374-14059396 CCTTCCAGGTAGCGGGGAGAGGG - Intergenic
1134524408 16:14932985-14933007 CCTCCCACGGAGTGGGAACACGG - Intronic
1134548493 16:15127956-15127978 CCTCCCACGGAGTGGGAACATGG + Intronic
1134711996 16:16331472-16331494 CCTCCCACGGAGTGGGAACACGG - Intergenic
1134719853 16:16374765-16374787 CCTCCCACGGAGTGGGAACATGG - Intergenic
1134947573 16:18337120-18337142 CCTCCCACGGAGTGGGAACATGG + Intergenic
1134954832 16:18377222-18377244 CCTCCCACGGAGTGGGAACACGG + Intergenic
1135141687 16:19927532-19927554 CCTCCTAGAAGGAGGGGAGATGG + Intergenic
1135277623 16:21127176-21127198 CCTCCCAGGGAATGGTGATAGGG + Intronic
1136381510 16:29898189-29898211 CAGCCCAGGGAGAAGGGAGAGGG - Intronic
1136684570 16:31986619-31986641 CCTCCCAGGGAGGGAGCAGCAGG + Intergenic
1136785194 16:32930155-32930177 CCTCCCAGGGAGGGAGCAGCAGG + Intergenic
1136884588 16:33923649-33923671 CCTCCCAGGGAGGGAGCAGCCGG - Intergenic
1137291154 16:47052852-47052874 CCTAGCAGGGAGAGAGGAAAAGG + Intergenic
1137983243 16:53087278-53087300 TCTTCCAGGGAGAGGGCACACGG + Intronic
1138526722 16:57612742-57612764 CCTCCCTGGGAGTGGGGTGGGGG + Intronic
1138580193 16:57935913-57935935 CAAGCCAGGGAGAGGAGAGAAGG + Intronic
1139164725 16:64552607-64552629 GCTCCCAGGGACTGGAGAGAGGG - Intergenic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1139597532 16:67967027-67967049 CCTCCCAGGGTTAGGGAAGCAGG + Intronic
1140401561 16:74676118-74676140 CCACTCAGTGAGAGTGGAGAGGG + Intronic
1140659678 16:77176089-77176111 CATCTCAGAGAGAGGGAAGAGGG - Intergenic
1140990908 16:80210488-80210510 CATCCCAGAGAGAGGGAAAAGGG + Intergenic
1141245429 16:82302615-82302637 TCTCCCACGGTGGGGGGAGAGGG - Intergenic
1141602151 16:85133576-85133598 CTTCCCAAGGAGAGGGGAGGGGG - Intergenic
1141688561 16:85583860-85583882 GCTCCCAGGGAGGGGAGTGAGGG + Intergenic
1141733551 16:85838020-85838042 ACTACCAGGGAGAGGGAGGAGGG + Intergenic
1141788298 16:86216331-86216353 CCTCCCACAGAGAGGGAAGGAGG + Intergenic
1141832483 16:86517447-86517469 CTTCCCAGGGATAAGGAAGATGG + Intergenic
1141851670 16:86650314-86650336 CCTCCAAGGGAGAGGTGCAAGGG - Intergenic
1142228747 16:88889557-88889579 CCCCCCAGGTAGTGGAGAGAGGG - Intronic
1142374478 16:89700182-89700204 CCTCCCAGGGGGCGGGGCGGGGG - Intronic
1203087854 16_KI270728v1_random:1194164-1194186 CCTCCCAGGGAGGGAGCAGCAGG + Intergenic
1142519892 17:497488-497510 CCTACAAGGGAGCGGGGAGAGGG - Intergenic
1142728301 17:1832245-1832267 CCACCCAGGCAGTGGGCAGAGGG - Intronic
1142954321 17:3510912-3510934 CCTCCCTGGGATGTGGGAGAAGG - Intronic
1142969416 17:3601204-3601226 GCTCCCAGGTAGAGGAGGGATGG - Intergenic
1142978105 17:3657071-3657093 CCTGCCAGGGAGGAGGGAGGAGG + Intronic
1143015122 17:3887577-3887599 CCTCCCTGGAGGAGGTGAGAGGG + Intronic
1143015164 17:3887721-3887743 CCTCCCTGGAGGAGGTGAGAGGG + Intronic
1143129951 17:4671874-4671896 CCTCCCAGGGAGAGGTGGAGAGG - Exonic
1143184166 17:5000507-5000529 CCTCCCAGGGACTGGGAACACGG - Intronic
1143513347 17:7407607-7407629 CCTCCCAGGGAGGTGGGAGCTGG + Intronic
1143514479 17:7412995-7413017 TCTCCCAGTGTGAGGGGAGGAGG - Intronic
1143788341 17:9273495-9273517 CCTCGCTGGCAGTGGGGAGAGGG - Intronic
1144728073 17:17511705-17511727 CCTCCCAGTGAGCAGGGAGTTGG - Intronic
1146417558 17:32650494-32650516 TCTCTGAGGGAGAGGAGAGAAGG - Intronic
1146445372 17:32928313-32928335 GCTGCCGGGGAGAGGGGAGGCGG + Intronic
1147041520 17:37722960-37722982 CCTGCCAGGTAGAGGGGTGTGGG - Intronic
1147145505 17:38482300-38482322 CCTCCCAGGGAGGGAGCAGCAGG + Intronic
1147228576 17:39000706-39000728 GCTTTCAGGGGGAGGGGAGATGG - Intergenic
1147256494 17:39185085-39185107 CATCCCAGGGAGTGGGGAGGAGG + Intronic
1147867391 17:43562187-43562209 TCTTCCTAGGAGAGGGGAGAAGG + Intronic
1147869599 17:43578155-43578177 CCCCCCAGGCAGAGGAGAGAGGG + Intronic
1147972634 17:44227797-44227819 CCTCCCAGCCAGGGGGAAGATGG - Intergenic
1148115499 17:45172523-45172545 GCTGCCAGGGAGTGGGGGGAGGG + Intergenic
1148463550 17:47851364-47851386 ACTCCCAGGGAGAGGGGCCCGGG + Intronic
1148581862 17:48749831-48749853 CCTCCCAAGCAGAGGGGTGTCGG + Intergenic
1148680471 17:49470599-49470621 CCTCCGAGAGTGTGGGGAGATGG + Intronic
1148751236 17:49947010-49947032 CCCCCCAGTCTGAGGGGAGAGGG - Intergenic
1148864133 17:50619791-50619813 CCTCCCAGGCTGGGGGCAGAAGG - Exonic
1149335710 17:55633639-55633661 GTTCCCAGGGAGATGGAAGATGG + Intergenic
1149546347 17:57506604-57506626 CTTCCGAGGGAGTAGGGAGAAGG + Intronic
1149596051 17:57865353-57865375 CTGCCCAGGCAGAGAGGAGAGGG + Intronic
1149868078 17:60161635-60161657 CAGCCCAGGGAGAGGAGAGACGG + Intronic
1150209769 17:63435632-63435654 CCTACCAGGGAGGTGGGAGGAGG - Intronic
1150294829 17:64002087-64002109 CATCCCAGAGAGAGGGGTGAGGG - Exonic
1150591464 17:66566239-66566261 CATCCCAGGGAACGGGCAGATGG + Intronic
1151432401 17:74072377-74072399 CCTCAGAGGCACAGGGGAGAAGG - Intergenic
1151458611 17:74241574-74241596 GCTCCGAGGGAGAGAGGGGAGGG - Intronic
1151945550 17:77318106-77318128 CAGACCAGGGAGTGGGGAGATGG - Intronic
1152061780 17:78081634-78081656 CTTCCCAGGAACAGGGGAAAAGG + Intronic
1152133605 17:78491640-78491662 CCTCCCAGAGAGAGAGGCCAGGG - Intronic
1152250370 17:79209343-79209365 CCTCCCAGGGGGCAGGGACAAGG + Intronic
1152271866 17:79329563-79329585 CCTTCCAGGGAAGGAGGAGAGGG - Intronic
1152794765 17:82301531-82301553 TCTCCCTGGGAGGAGGGAGAAGG + Intergenic
1152808960 17:82372146-82372168 CCACCCTGGGCGAGGGGAGCGGG + Intergenic
1152903979 17:82960592-82960614 CCTCACAGTGACACGGGAGAGGG + Intronic
1154325765 18:13389444-13389466 CCTCCTGGGGTGTGGGGAGAAGG - Intronic
1155020959 18:21896823-21896845 CGTCCCCAGGGGAGGGGAGATGG - Intergenic
1156478629 18:37422229-37422251 CCTCCCACTGAGATGGGAGCAGG + Intronic
1156651377 18:39230369-39230391 CCTCCCACGGAGGTGGTAGAAGG - Intergenic
1157273594 18:46294723-46294745 GCTCCCAGGGGAAGGGGACAGGG - Intergenic
1157730617 18:50001146-50001168 GCTCTCAGGGAGAGGCGTGAAGG + Intronic
1158137515 18:54223992-54224014 CCTCCCTGGGGGCGGGGAGGGGG - Intronic
1158201557 18:54947313-54947335 GCTCCCAGGGAGGAGGCAGAGGG + Intronic
1158241202 18:55380219-55380241 CCTCACATGGAGAAGAGAGAAGG + Intronic
1160080996 18:75727030-75727052 GAGCACAGGGAGAGGGGAGAAGG - Intergenic
1160429755 18:78803403-78803425 CCTCCATGGGAGAGTGCAGAAGG + Intergenic
1160613972 18:80109741-80109763 CCGCCCCGGGAGGGCGGAGAAGG + Intronic
1161113606 19:2484152-2484174 ACTCCCAGAGGGAGGGGAGAAGG + Intergenic
1161330985 19:3687770-3687792 CCCGGCAGGGAGAAGGGAGAAGG - Intronic
1161331787 19:3692073-3692095 GCGCCCAGGGAGTGGGGACAGGG - Intronic
1161579626 19:5073655-5073677 CATTCCAGGGAGAGGGGATGTGG - Intronic
1161794983 19:6381279-6381301 CCTGCAGGGGAGAGGGGAGGAGG + Intronic
1161812723 19:6479795-6479817 TCTCCCAGGGGGAGGGGACTTGG - Intronic
1162071001 19:8151956-8151978 CCTCCAGAAGAGAGGGGAGAAGG + Intronic
1162106605 19:8373683-8373705 CCTGCCGGGGTCAGGGGAGAGGG - Exonic
1162377046 19:10310844-10310866 CCTCCCGAGGAGAGGTGAGTGGG - Exonic
1162739444 19:12765780-12765802 CTTCCCAGGGTGAGGGTAGGGGG + Intronic
1163346710 19:16747721-16747743 CTGCGCTGGGAGAGGGGAGATGG - Intronic
1163502601 19:17685958-17685980 TCTCCCAGGGAGAGGTGGGATGG - Intronic
1163548587 19:17952844-17952866 CCTGTCCGGGAGAGGGGAGGGGG - Intronic
1163583452 19:18151860-18151882 ACTCGCAGGGAGAGGGTAGCAGG - Intergenic
1164574287 19:29396632-29396654 CTCCCCAGGGACAGGGGAGCAGG + Intergenic
1164684677 19:30158949-30158971 CCACCCAGGGAGGGGAGAGGAGG - Intergenic
1164756314 19:30692337-30692359 TCTCCCAGAGACAAGGGAGAAGG - Intronic
1164761776 19:30733516-30733538 CGTCCCAGGGTGAGGTGTGATGG - Intergenic
1165316753 19:35060605-35060627 CCTACCAGGGAAAGGGGTGGAGG - Exonic
1166387365 19:42389652-42389674 GCTCTCAGGGGGAGGGGAGCTGG + Intronic
1166938800 19:46350681-46350703 CCTCCCCGGGGGCTGGGAGATGG + Intronic
1166943771 19:46384657-46384679 CCTCCCAGGGAGTGAGGACTTGG - Intronic
1166953596 19:46446983-46447005 CCTCCAAGGGGCAGGAGAGAAGG + Intergenic
1166998301 19:46730285-46730307 CCTCCCAGGGAGAGGTCAGGAGG + Intronic
1167032796 19:46974719-46974741 CCTCTGGGGGTGAGGGGAGAGGG - Intronic
1167040270 19:47019724-47019746 CCTACCAGGGAAAGGCGAGCAGG + Intergenic
1167649114 19:50719853-50719875 GCTCCCGGAGGGAGGGGAGAGGG - Intergenic
1167814770 19:51870025-51870047 CCTCCCAGGGAGGGACCAGAAGG - Intronic
1168464374 19:56589855-56589877 GCTCACTGGGAGAGGTGAGAGGG + Intergenic
925836474 2:7951490-7951512 CCTCCCAGGGCAGGGAGAGAGGG + Intergenic
925970512 2:9103540-9103562 GAGCCCAGGGTGAGGGGAGAGGG + Intergenic
926750610 2:16196020-16196042 CCTACCAGGGGAAGGGCAGAGGG - Intergenic
926760578 2:16275324-16275346 CCTTCCAAGGAGATGGGAAAAGG + Intergenic
926961414 2:18362309-18362331 CCTCCCCGGCAGAGTGGAGATGG + Intergenic
927454955 2:23241393-23241415 CCTTTCAGGGAGAAAGGAGAGGG - Intergenic
927468092 2:23351786-23351808 CCTCCCCGGGAGAGGAGGGCAGG - Intergenic
927517795 2:23682198-23682220 TTTCCGAGGGAGAGGTGAGAAGG - Intronic
927666453 2:25036233-25036255 CCTCCCAGAGGGAGGGAAGAGGG - Intergenic
927758014 2:25724126-25724148 TCGGCAAGGGAGAGGGGAGAGGG + Intergenic
927810003 2:26175453-26175475 CCTCCCAGTTACAGGGGTGACGG - Intronic
928173048 2:29015745-29015767 CCAGCCAGGGATAGGGGTGAGGG + Intronic
928238268 2:29564200-29564222 TATCCCAGGGAGTTGGGAGAAGG - Intronic
928331744 2:30362771-30362793 GCTAACAGGGAGAGGAGAGAAGG + Intergenic
929594155 2:43165636-43165658 TGTTCCAGGGAAAGGGGAGATGG - Intergenic
929618130 2:43328339-43328361 CCTCCCTGGGGGAGGTGTGACGG + Intronic
930189347 2:48441402-48441424 CATCCCTGTGGGAGGGGAGAAGG - Intronic
930476764 2:51891831-51891853 TATCCCAGGGAGATGGGAGTTGG - Intergenic
931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931622476 2:64224849-64224871 ACTCCCAAAGAGAGGGAAGAAGG - Intergenic
931667760 2:64622679-64622701 CCACCCAGGGACACTGGAGAGGG - Intergenic
932324472 2:70848155-70848177 CCTCTCAGGGAGTGGGGAGCTGG + Intergenic
932568175 2:72922498-72922520 CATCACAGGGAGATGGGTGAGGG - Intronic
933485812 2:82922304-82922326 CCTCCCATTGGGATGGGAGAAGG + Intergenic
933782273 2:85811012-85811034 CCTGGCAGGGAGAGGGGTGCTGG + Intergenic
934654437 2:96109943-96109965 CCTCCCAGGGAGCTGGGGCAGGG + Intergenic
934771056 2:96907818-96907840 CCTCCCAGGGAGTGAAGACAAGG - Intronic
934853440 2:97715233-97715255 TGTCCCAGGGAGACGGGAGGAGG - Intronic
934973859 2:98786570-98786592 TCTCCCAAGGAGGGGGCAGAGGG - Intergenic
935370845 2:102345226-102345248 ACACCAAGGGAGTGGGGAGAAGG - Intronic
936090954 2:109501145-109501167 CCTCCCAGGGGCAGGGGCGGGGG - Intronic
936096070 2:109531068-109531090 CCTCCCTGCTAGATGGGAGATGG - Intergenic
936232137 2:110712287-110712309 CCTCCTAGTGAGAAGGGGGAAGG - Intergenic
936561199 2:113541473-113541495 ACTCCCAGGGAGACAGGGGACGG + Intergenic
937986362 2:127639911-127639933 CCACCCAGGGAGATGGGGGCAGG - Intronic
938403947 2:131016869-131016891 CCACCCAGGGAGAGAGGTGGAGG - Intronic
938942135 2:136178630-136178652 TCTTCAAGGGAGAAGGGAGAGGG + Intergenic
938969559 2:136419837-136419859 CCAGGCAGGGAGAAGGGAGACGG - Intergenic
941853401 2:170206722-170206744 CCACCCAGGGAAAAGGGAGAGGG - Intronic
943258474 2:185628320-185628342 CCTCCCTGGAATAGGGGAAAGGG + Intergenic
943707591 2:191051714-191051736 CTTCCCTGGGAGAGGCGAGCTGG - Intronic
944190881 2:197002668-197002690 TCTCCCAGGAAGAAGGGTGATGG + Intronic
944242608 2:197500285-197500307 CCTCCCTGGGAGGGGCGAGGGGG + Exonic
944699945 2:202238106-202238128 CCTCCCAGGGAGGTGGAAGCGGG + Intronic
945914024 2:215683495-215683517 CCTGTCAGGGAGAGCAGAGAGGG + Intergenic
946020671 2:216637771-216637793 CCTGTCAGGCAGAGGGAAGAGGG + Intronic
946413966 2:219530103-219530125 GTTCCCAAGGAGAGGGGAGGGGG + Intronic
946917960 2:224545707-224545729 TCTCTGAGGGAGAGGGGAGAAGG + Intronic
947685269 2:232078381-232078403 CCTCCCGGGGAGCGGGGCGGGGG - Intronic
947834806 2:233167548-233167570 CCTCCCAGGTTGCGGGCAGAGGG + Intronic
947911077 2:233801367-233801389 TCACCCAGGGAGAGAGGAGATGG + Intronic
948242155 2:236446816-236446838 TGTCCCAGGGAGAGGGCAGAGGG + Intronic
948321405 2:237072586-237072608 CCTCCCAAGTAGAGGTGAGAGGG - Intergenic
948483871 2:238267776-238267798 GCAGCCAGGGAAAGGGGAGAAGG + Intronic
948584351 2:239009638-239009660 CCTCCCAGAGGGAGGCGAGTGGG - Intergenic
948681169 2:239635593-239635615 CCACTCAGGGGGTGGGGAGATGG - Intergenic
948689230 2:239691513-239691535 CCTCCCAGGGAAAGACGGGATGG + Intergenic
948856857 2:240734272-240734294 CCTTGCAGGGAGAGGGGAGCGGG + Intronic
1168993129 20:2111866-2111888 TCTCCCAGGATGAGGGGAGTGGG - Intronic
1169014028 20:2276866-2276888 ACTCCAAAGGAGAGTGGAGAGGG - Intergenic
1169422823 20:5473435-5473457 CATCCGAGGGAGGGAGGAGAGGG + Intergenic
1169426603 20:5502040-5502062 CATCCAAGGGAGGGAGGAGAGGG - Intergenic
1169503121 20:6180577-6180599 GCTCTCAGGGAAAGGGGAGTGGG - Intergenic
1169633199 20:7656994-7657016 CATTCTAGGGAGAGGGGGGAGGG + Intergenic
1169889087 20:10433760-10433782 CCTCCCAGCGAGGGAGGGGACGG + Intronic
1170980485 20:21207566-21207588 CCTCTAAGGGAAAGGGGGGAGGG - Intronic
1171124261 20:22587597-22587619 CTTCCCAGGGAGAGCAGAGGAGG - Intergenic
1172028833 20:31967914-31967936 CCTCCGAGGAAGGAGGGAGAGGG + Intergenic
1172118262 20:32584033-32584055 CCTCCCAGCGCCAGGGGAGGGGG - Intronic
1172290161 20:33770303-33770325 CCACCCAGGGAGAGGGAAGCAGG - Intronic
1172304239 20:33870298-33870320 CCTCCCTGTGGGAGAGGAGAGGG + Intergenic
1172935780 20:38619142-38619164 CATTCCAGGCAGAGGGAAGAAGG + Intronic
1174419652 20:50391252-50391274 CCTACCAGGGAGAGAGGGGAAGG - Intergenic
1175244284 20:57572286-57572308 GCTGCTAGGGAGAGGGGAGAAGG - Intergenic
1175316558 20:58052714-58052736 CCTCCCCAGGAAAGGGGACATGG - Intergenic
1175542427 20:59756101-59756123 CTTCCCAAGGATAGGGGAGAAGG + Intronic
1175929809 20:62488365-62488387 CCTCGCAGGGAGCTGGGAGGTGG + Intergenic
1175939474 20:62531393-62531415 CCTCCCAGGAAGGGGGGTGGCGG - Intergenic
1175963394 20:62648222-62648244 GCTCCCAGGGAAAGGGCAGCTGG + Intronic
1176092402 20:63325089-63325111 CCTCCCAGGGTGAGCAGTGAGGG + Intronic
1176119673 20:63448674-63448696 CCTCTGTGGGAGTGGGGAGAGGG - Intronic
1177968464 21:27759100-27759122 GCTCTCAGCAAGAGGGGAGATGG - Intergenic
1178429833 21:32509447-32509469 CCTCCCAGGAGAAGAGGAGAGGG + Intronic
1178833358 21:36074880-36074902 CCTCTGAGGGTGAGGGGAGGAGG + Intronic
1179438818 21:41379499-41379521 CCTCTCAAGGAGTGGGAAGAAGG - Intronic
1179719750 21:43308323-43308345 CCTCCCAGGGAGTGTAGAGGAGG + Intergenic
1179884646 21:44308508-44308530 CCTCCCAGGGAAAGGGGCATGGG + Intronic
1180001760 21:44998354-44998376 CCTGCCAAGGTGAGGGGACAGGG - Intergenic
1180001774 21:44998395-44998417 CCTGCCAAGGTGAGGGGACAGGG - Intergenic
1180285690 22:10742335-10742357 TCTCTCTTGGAGAGGGGAGAAGG + Intergenic
1181437929 22:22921192-22921214 CCCCAGAGGGAGAGGGGAGAGGG - Intergenic
1181591789 22:23889794-23889816 CTTCCCAGGGCCAGGGGACAGGG + Intronic
1182011661 22:27006331-27006353 CCCCCCAGGGAGTTGGGAGCTGG + Intergenic
1182101824 22:27662948-27662970 TCTCCCAGGGAGAGCGCAGTGGG - Intergenic
1183548401 22:38467658-38467680 CCTCCCTGGGAGAGTGGGGTGGG - Intergenic
1183834479 22:40440957-40440979 GGTAGCAGGGAGAGGGGAGATGG - Intronic
1183899574 22:40994904-40994926 CCTCCCCGGGGGAGGGGTGCTGG + Intergenic
1183984492 22:41562027-41562049 CTTCCCAGGGAGAGGGGAGGGGG + Intronic
1184007656 22:41722169-41722191 CATCCCTGGCTGAGGGGAGAGGG - Intronic
1184021944 22:41826808-41826830 CCTCCCAAGCAGAGGAGGGAAGG + Intergenic
1184536608 22:45091902-45091924 CATCCCTGGGAGAGGGGAACCGG + Intergenic
1184669871 22:46006983-46007005 CCCCCAGGGGAGAGCGGAGAAGG - Intergenic
1184870965 22:47238294-47238316 CCACCCAGGCTGAGGGAAGAAGG - Intergenic
1185190456 22:49433082-49433104 CCCGGCAGGGAGAGGGCAGATGG - Intronic
1185319314 22:50193231-50193253 CCTCCGAGGGAGAGGGGCGCTGG + Intronic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950362957 3:12462661-12462683 CCTCCCAGGCCCAGGAGAGAGGG - Intergenic
950867887 3:16203935-16203957 CCTCACATGGAGAGGAGAGGGGG + Intronic
950872011 3:16237736-16237758 CCTCCCAAGGAGAGTGGTCAAGG - Intergenic
950922362 3:16707488-16707510 GCTGCCAGGGAGATGGGACAGGG + Intergenic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
952707150 3:36391032-36391054 CCTGCCAGAGAGAGGGAAGATGG - Intronic
952899176 3:38098255-38098277 CCTTCCAGAGAGTGGGGAGGAGG - Intronic
953549112 3:43886740-43886762 CCTCCCACAGAAAGGGCAGAAGG + Intergenic
953610340 3:44442649-44442671 CCTCCAAGGGAGTGGGGGAAAGG + Exonic
954138988 3:48595375-48595397 CCTCTCAGGGATATGGGTGAGGG - Intergenic
954294336 3:49665867-49665889 CAGCTCAGGGAGAGGGCAGAAGG + Intronic
954524984 3:51261930-51261952 TATCCCAGGGAGATGGGAGTTGG - Intronic
954613718 3:51959150-51959172 CCTTCCAGGGAGAGTGGAAATGG - Intronic
955059188 3:55481919-55481941 GCTGCCAGGGAGGGAGGAGATGG + Intronic
956295543 3:67709363-67709385 CCTCCATGGGAGTGGGGAGCTGG + Intergenic
956567225 3:70652403-70652425 TATCCTAGAGAGAGGGGAGACGG - Intergenic
956765500 3:72481141-72481163 CCTCCCACGCAGAAGGCAGAAGG - Intergenic
957083459 3:75658443-75658465 CCCCCCAGGGGCAGGGGAGGAGG + Intergenic
958433139 3:94065387-94065409 CCTCCTAGGTTGAGGGAAGAAGG + Intronic
959056690 3:101574335-101574357 GCTCCCAGGGTGGGGGGAGTGGG + Intronic
959108141 3:102089608-102089630 GCTCACTGGGAGAGGAGAGAGGG + Intergenic
959220849 3:103517227-103517249 CCCTCCAGGGAGTGGGGAAAGGG + Intergenic
959631939 3:108516924-108516946 CATCCCAGTGGGAGGGGAGCGGG - Intronic
959991361 3:112635893-112635915 CCACTAAGGGAGTGGGGAGAAGG + Intronic
960321607 3:116243357-116243379 CCTGCCAGGAAGAGAGGAGCAGG + Intronic
961047891 3:123721925-123721947 CCTCTTAGGGACAGAGGAGAGGG - Intronic
961270066 3:125681639-125681661 CCTCTTAGGGACAGAGGAGAGGG + Intergenic
961393471 3:126570295-126570317 CCTCCTGGGGTGAGGGGAGCTGG + Intergenic
961412004 3:126729371-126729393 ACTCCAAGGGAGCGGGGAGCGGG + Intronic
962281810 3:134057806-134057828 CCTCCCTGGGGGAAGGGACAAGG + Intergenic
962364857 3:134772171-134772193 CCTCCAAGGGAGAGGGCAATGGG - Intronic
962658976 3:137581320-137581342 CTCCCCAGAGAGAGAGGAGAGGG + Intergenic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
962975381 3:140441698-140441720 CCACGCAGAGAGAGGAGAGAAGG + Intronic
963017502 3:140839839-140839861 CAGCCCAGGGAGAAGGCAGAGGG - Intergenic
963224371 3:142846728-142846750 ACTCACAGGTAGATGGGAGATGG - Intronic
963229042 3:142891415-142891437 CCTCACAGGGTGATAGGAGAAGG + Intergenic
965770595 3:172177848-172177870 CCTGTCAGGGACAGGGGTGAGGG - Intronic
966518977 3:180852543-180852565 TCTCCAAAGGAGAGGAGAGATGG + Intronic
966734909 3:183180539-183180561 GCTGCCAGGGAGATGGGAAATGG - Intronic
967078464 3:186026486-186026508 CCCCACGGGTAGAGGGGAGAGGG - Intergenic
967171469 3:186826151-186826173 GCTGCCAGGGAGATGGGAAATGG + Intergenic
967503115 3:190222848-190222870 CCTCCCAGTGAGAGGGAATAAGG + Intergenic
968010616 3:195271589-195271611 CCTCCCAGGGCGGGGGAAAAGGG - Intergenic
968319000 3:197749464-197749486 CGTGCCAGGGAGGGGGGAGCTGG + Intronic
968900582 4:3429815-3429837 CCTCCCAGGCCTAGGGCAGAGGG - Intronic
969057366 4:4410128-4410150 CCACGCAGGGAAAGGGGAGCAGG + Intronic
969228727 4:5815449-5815471 CCTCATAGGGAGACGGGAAATGG + Intronic
969339067 4:6529103-6529125 CCTCACAGGGACAGGGAAGGGGG + Intronic
969455713 4:7298604-7298626 GCTCCCACGGTGACGGGAGAGGG + Intronic
969876816 4:10141528-10141550 CCTCCCTGGGGGAGGGGTGGGGG + Intergenic
970303167 4:14702895-14702917 GCTCCCACGGAGTGGGGAGGTGG + Intergenic
970510352 4:16776087-16776109 ACTCCCAGGGAGATGGAAGGGGG - Intronic
971233686 4:24821707-24821729 GTTTCCAGGGAAAGGGGAGATGG + Intronic
971400749 4:26273439-26273461 CCTCCGAGGGAGCGTGGAGCGGG + Intronic
971483322 4:27133886-27133908 CTTTCCAGGGAGAGGGAACATGG + Intergenic
972405127 4:38738268-38738290 CCTTCCAGGGGGTGGGGCGAGGG + Intergenic
972571264 4:40312446-40312468 CATCCTAGGAAGAGGGAAGATGG - Intergenic
972671602 4:41217260-41217282 CCTCCTAGGGAGTTGGGGGAAGG + Intergenic
972783222 4:42303854-42303876 GCTCACAGAGAGAGGGGAAAAGG - Intergenic
973370119 4:49238562-49238584 CTTCCCAGATAGAGGGAAGAGGG + Intergenic
973390907 4:49556850-49556872 CTTCCCAGATAGAGGGAAGAGGG - Intergenic
974076281 4:57171296-57171318 CCTCATAGGGAGAGTGGAGCAGG - Intergenic
974123376 4:57666355-57666377 CCTCCAAGAGAGATGGGAGGTGG - Intergenic
975683295 4:76897119-76897141 GCTTCCAGGGAGCGGGAAGAAGG - Exonic
976266529 4:83190584-83190606 TCTCCAAGGAAGAAGGGAGAAGG + Intergenic
977334036 4:95673539-95673561 TGTGCCAGGGAGAGTGGAGAAGG - Intergenic
978365071 4:107972940-107972962 CTTCCCAGGGAAGGGGGAAAGGG - Intergenic
978405130 4:108371114-108371136 GCTCCTAGGGAGGAGGGAGAGGG - Intergenic
979555823 4:122046123-122046145 CCTTCCAGAGAAAGGGCAGAAGG + Intergenic
979858366 4:125662988-125663010 CTTCATAGGGAGAGGGGAGAAGG + Intergenic
980445092 4:132894750-132894772 CCTGTTCGGGAGAGGGGAGATGG + Intergenic
981044530 4:140253065-140253087 GCGCCCAGGGAGAGAGGAGGAGG + Intergenic
981567693 4:146117778-146117800 CATCTCAGGGAAGGGGGAGAAGG + Intergenic
982689789 4:158535108-158535130 TTTCCCAGGGAGAGGAGAGAAGG + Intronic
983586284 4:169358540-169358562 AGTCCCAGAAAGAGGGGAGAGGG + Intergenic
983831877 4:172338471-172338493 CCCCCCAGGAAGGGGGTAGAGGG - Intronic
984639293 4:182144612-182144634 CCGCCGAGGGAGCGGGGAGCGGG - Intronic
985082493 4:186280415-186280437 CCTCACAGGCAGACGGGACAAGG - Intronic
985189347 4:187354934-187354956 GCTGGCAGGGACAGGGGAGAAGG + Intergenic
985644653 5:1079239-1079261 CCTCCCTGGGAGACGGGGCAAGG - Intronic
985711538 5:1432352-1432374 ACTCCCAGGGTGCGGGGAGGGGG - Intronic
985759457 5:1737639-1737661 CCTCCCAGGGTCAGGTGAGGAGG - Intergenic
986233132 5:5885104-5885126 GCTCCGTGGGAGATGGGAGAGGG - Intergenic
986685234 5:10270577-10270599 CCTCAGTGGGGGAGGGGAGAGGG + Intergenic
987862803 5:23507757-23507779 CTTCCCAGGGTGAGGGGATCTGG - Intronic
988903282 5:35756776-35756798 TCTCCCAGGGAGAGGGAAGAAGG - Intronic
988932702 5:36052569-36052591 CCTACCAGGGATAAGAGAGAAGG - Intronic
989042498 5:37243429-37243451 CCACCCTGAGAGTGGGGAGAGGG + Intronic
990546236 5:56824497-56824519 CCTGACAGTGAGAGGAGAGAGGG + Intronic
991584419 5:68187654-68187676 CCTGTCACGGAGACGGGAGATGG + Intergenic
992279175 5:75156026-75156048 CCTCCCAGGTAGCTGGGAAAAGG + Intronic
992371333 5:76147048-76147070 CATCCAAGGGAGAGGGGAATGGG + Intronic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
993749463 5:91649215-91649237 GCTCACTGGGAGAGGAGAGAGGG + Intergenic
993816514 5:92554833-92554855 TCCCCCAGGGAGTGGGGTGAGGG + Intergenic
994352541 5:98763419-98763441 CCCCCCAGGGCCAGGGGAAAAGG + Intergenic
994670413 5:102755676-102755698 CCCCCTAGGGAGAGGGCACAAGG - Intronic
994784387 5:104137656-104137678 CCTCCATGGAACAGGGGAGAGGG + Intergenic
994880447 5:105486880-105486902 CCTCCCAGTGAATGGGTAGAGGG - Intergenic
995062941 5:107831156-107831178 CATCCCAGAGAGAGAGGTGAGGG + Intergenic
995469380 5:112484419-112484441 CATCCCAGGGAGAGAGGAGCGGG + Intergenic
995481577 5:112598670-112598692 CCTCCCAGGGCAAGTGGGGAGGG - Intergenic
995726929 5:115191091-115191113 CCTCCTAGGATGAGGGGAGGTGG + Intergenic
997206861 5:132055251-132055273 CCTCCCAGGGAGAGAGGGGAAGG - Intergenic
998268887 5:140689188-140689210 ATTCCAAAGGAGAGGGGAGATGG - Intronic
998408066 5:141885766-141885788 ACTTCCAGGAAGAAGGGAGAGGG - Intergenic
999144525 5:149383550-149383572 CCTACCAGGGAGGGAGGGGAGGG - Intronic
999267414 5:150275922-150275944 CCTCCCTGAGAATGGGGAGAGGG + Intronic
999410609 5:151346743-151346765 CTTTCCAGGGAGTGGGGAGTGGG - Intronic
999964852 5:156798383-156798405 CCTCCCCTGGAAAGGGGAGGGGG + Intergenic
1000651731 5:163826403-163826425 CATCCAAGGGACAGGGGAAATGG - Intergenic
1000884163 5:166732320-166732342 CTGCCCAGAGAGAGGTGAGAGGG + Intergenic
1001440036 5:171735674-171735696 CCTCCCAGAGAGAGCAGAGATGG + Intergenic
1001740199 5:174046830-174046852 CCTCCAAGGGAGTGATGAGAGGG - Exonic
1001802576 5:174556957-174556979 CCTCCCAGTGAGAGTTGAAAGGG + Intergenic
1002484236 5:179523767-179523789 CCTCCTGGGGAGAGAGGACAGGG - Intergenic
1003191649 6:3880121-3880143 CATGCCAGGGAGGAGGGAGATGG - Intergenic
1003303619 6:4907214-4907236 CCTCCTACAGAAAGGGGAGATGG + Intronic
1003540962 6:7017673-7017695 CAGCCCAGGGAGTGGGGAGGAGG + Intergenic
1004087472 6:12464863-12464885 ACTCCCAGGGAGGTAGGAGAAGG - Intergenic
1006149493 6:31979107-31979129 CATCCCATGGAGAGGGCACAGGG + Intronic
1006275415 6:33001394-33001416 CCTCCCAGGGACGGGGAAGTTGG + Intergenic
1006404660 6:33837993-33838015 CCCTCCAGGGACAGGAGAGAGGG + Intergenic
1006840751 6:37026643-37026665 CGTCCCTGGGAGGTGGGAGAAGG + Intronic
1006897154 6:37478556-37478578 CCTGGCGAGGAGAGGGGAGAGGG - Intronic
1007307771 6:40920291-40920313 CCTGGCAGGGAAAGGGGAGAGGG + Intergenic
1007408828 6:41649852-41649874 TCTCCCAGGGAGAGATGGGATGG - Intronic
1007577149 6:42932586-42932608 CCTCCCCAGGAGTGGGGAAAGGG - Intronic
1007754461 6:44090031-44090053 GCTCCCAGGGAAACTGGAGAGGG + Intergenic
1008729985 6:54469954-54469976 GCTACTAGTGAGAGGGGAGATGG + Intergenic
1008952995 6:57181316-57181338 CATCTCTGGGAGAGTGGAGAGGG + Intronic
1009994019 6:70879533-70879555 ACTGCCAGGGACTGGGGAGAAGG + Intronic
1010248962 6:73688653-73688675 CATCCTCTGGAGAGGGGAGAAGG + Intergenic
1011552242 6:88540456-88540478 CCGCCAAGGGAGAGGGCAGAGGG - Intergenic
1011972255 6:93240976-93240998 CTTTACAGGGAAAGGGGAGAAGG - Exonic
1012986795 6:105884331-105884353 GGTCCAAGGCAGAGGGGAGAGGG + Intergenic
1014368642 6:120577378-120577400 CCTACAAGGGAAAGGGCAGATGG + Intergenic
1015640612 6:135327732-135327754 CCTCCAGGGTAGAGGGGGGAAGG - Intronic
1015851493 6:137577975-137577997 CATCCCATGGACAGGAGAGATGG - Intergenic
1015953416 6:138576477-138576499 CCTGACAGTGAGAGGGGAGGGGG - Intronic
1016211366 6:141539016-141539038 CCCCCCAGTGAGAAGGGTGAGGG + Intergenic
1017087363 6:150726097-150726119 CTTGCCAGGGAGTGGGGAGAGGG + Intronic
1017323804 6:153123850-153123872 CCTACAAGTGAGAGGGGAAAAGG + Intronic
1018163380 6:161069811-161069833 GCTCCCATGGAGCAGGGAGAAGG + Intronic
1018722372 6:166582113-166582135 GGGCCCAGGGAGAGGTGAGATGG + Intronic
1018921470 6:168178921-168178943 CAGGCCAGGGAGAGGAGAGAAGG - Intergenic
1019337291 7:491431-491453 CCACCCAGGGAGGGGCGAGCAGG + Intergenic
1019907370 7:4074991-4075013 CCTCCCAGGGAGAGGGGAGAAGG - Intronic
1019928743 7:4209596-4209618 CCTCTGAGGGAGAGGCGAGGAGG + Intronic
1020259554 7:6523257-6523279 ACTTCCCGGGAGAGGCGAGATGG + Intronic
1020667800 7:11069451-11069473 CCTCCCTGGGACAGAGGGGATGG - Intronic
1020722977 7:11772709-11772731 CTTGCCAGGGGGAGGGTAGAAGG + Intronic
1021859239 7:24889838-24889860 TTGCCCAGGGAGAGGTGAGAAGG + Intronic
1021951131 7:25776156-25776178 GCTCCTAGGGAGAGGGGCCAGGG + Intergenic
1022652268 7:32288030-32288052 CCTCCCAAGTAGCTGGGAGATGG - Intronic
1022891164 7:34701269-34701291 ACTCCCAGGGAGAGGATATATGG - Intronic
1023365294 7:39457846-39457868 CCTCTCTGAGAGAGGGAAGAAGG - Intronic
1023562711 7:41492471-41492493 CCTCACAGGGAGTGGTGGGAAGG + Intergenic
1023672196 7:42589112-42589134 CCTACCAGGGACTGGGGAGGTGG - Intergenic
1023842264 7:44104288-44104310 CCTCCCCGGGGGTGGGGAGCCGG + Intergenic
1023998038 7:45174017-45174039 CCTCCTAGGGAGATGGGAGTGGG + Intronic
1024215659 7:47246162-47246184 CCTACCAAGGAGAGGAGGGATGG + Intergenic
1025251294 7:57353238-57353260 CCTACCAGGGAGAGAGGGGAAGG + Intergenic
1026255443 7:68707276-68707298 CCTGCTAGGGAGAAGAGAGAGGG - Intergenic
1026479469 7:70765426-70765448 CCTCCCAAGGAGACAGGAGAAGG - Intronic
1026993500 7:74601223-74601245 CCTGCCAGACAGAGGGGTGAGGG - Intronic
1028868510 7:95739242-95739264 TCCCCCAGGGAGAGGGGAAAAGG + Intergenic
1029269728 7:99369900-99369922 CAGACCAGGGAGATGGGAGATGG - Intronic
1029459985 7:100688836-100688858 CCTCCCAGAGAGGGTGGCGAGGG - Exonic
1029538140 7:101167606-101167628 CATCCAAGAGAGAAGGGAGAGGG + Intergenic
1032016211 7:128381788-128381810 CCTGCCAGGGAAAGGAGAGTGGG + Intergenic
1032195457 7:129785953-129785975 CCTCCCAGGGCGCGGGAGGAGGG + Intergenic
1032351133 7:131165073-131165095 CCAGCCAGGGAGAGTGGGGATGG + Intronic
1032387803 7:131536648-131536670 CCTCCCAGGGGGAGGGGCGCTGG - Intronic
1034015802 7:147584879-147584901 GCTCCCAGGATCAGGGGAGAAGG + Intronic
1034237413 7:149583145-149583167 CCTCCCAGGCAGCAGGAAGATGG - Intergenic
1034311127 7:150089512-150089534 CTTCCTTGGGAGAGTGGAGAGGG + Intergenic
1034424123 7:151005358-151005380 CCTCCCAGGGGGAAGGAAGCTGG - Intronic
1034488970 7:151382785-151382807 GCTCACAGGGAAATGGGAGATGG + Intronic
1034795726 7:154011132-154011154 CTTCCTTGGGAGAGTGGAGAGGG - Intronic
1034924352 7:155109349-155109371 ACTTCCAGGGTGAGGGGAGGAGG + Intergenic
1035056679 7:156040600-156040622 CCTCCCAGGAAGGGAGGAGCTGG - Intergenic
1035366158 7:158350258-158350280 CCTGCCAGAGGGAGCGGAGATGG - Intronic
1035486798 7:159232487-159232509 CCACCCAGGGAGAGGCTTGACGG + Intergenic
1036177577 8:6553729-6553751 CCCCTCAGGCAGAGGGGAAATGG + Intronic
1036664444 8:10729907-10729929 CGCCCCAGGGGGCGGGGAGACGG - Intronic
1037526000 8:19724833-19724855 CCTTTCAGGGAGAGTGGAGTGGG + Intronic
1037575454 8:20197930-20197952 CTCACCAGGGGGAGGGGAGAAGG - Intronic
1037674281 8:21040987-21041009 GTACCCTGGGAGAGGGGAGAGGG - Intergenic
1039492822 8:37960558-37960580 CTTTCCACGGACAGGGGAGAAGG + Intergenic
1039598894 8:38816871-38816893 CCTTCCAGGGAGGGGAGAAAGGG - Intronic
1040602219 8:48896540-48896562 CCACCCAGGGCCAGAGGAGAAGG - Intergenic
1041812521 8:61927518-61927540 CATGCCAGGGACAGTGGAGAGGG - Intergenic
1041881065 8:62750568-62750590 CCTCCCAGGGACAGAGGCGCCGG - Intronic
1042837318 8:73090535-73090557 CCTCCGAGGGTGAGAGCAGAAGG - Intronic
1043912166 8:85875693-85875715 CATCCCAGGTAGTGGGAAGAGGG - Intergenic
1044924006 8:97194430-97194452 GGCCCCAGGGAGAGGGCAGAGGG + Intergenic
1045305068 8:100951424-100951446 CGGCCGAGGGAGAGGGGAGGGGG + Intronic
1046472442 8:114694286-114694308 TCTCCGGGGGAGCGGGGAGAGGG + Intergenic
1047175706 8:122538365-122538387 ACTCACAGGCAGAGGTGAGAGGG + Intergenic
1047245783 8:123143136-123143158 CATTCCAGGCAGCGGGGAGAAGG + Intronic
1047554248 8:125911640-125911662 CCTCCCAGGGAGACTGGGGGAGG - Intergenic
1047931461 8:129732376-129732398 CCCCCTAGGGAGGGGGGAAAAGG + Intergenic
1047934745 8:129765864-129765886 CCTCCCAGGTCTTGGGGAGAAGG - Intronic
1048952001 8:139504304-139504326 CCACACAGGGACAGGGAAGAGGG - Intergenic
1049205564 8:141361927-141361949 CCTCCAGGGGAGGGGGCAGAGGG + Intronic
1049725187 8:144142485-144142507 CCTGCATGGGAGAGGGGAGGCGG + Intergenic
1049754576 8:144304164-144304186 ACACTCAGGGAGAGGGGAGCAGG - Intronic
1051074509 9:13215128-13215150 GCTCCCAGGGACTGGGGAGAGGG - Intronic
1051866211 9:21685728-21685750 GCTTCCAGGGAGAGTGAAGAAGG - Intergenic
1052991921 9:34523381-34523403 CCTTCCCGGGAGAGGGGATGGGG + Intergenic
1053174494 9:35912213-35912235 AGACCCTGGGAGAGGGGAGAGGG - Intergenic
1055197623 9:73615570-73615592 CCTTCCAGGGAGAAGGTACAAGG + Intergenic
1055358196 9:75459912-75459934 TCTGTCAGGGGGAGGGGAGATGG + Intergenic
1055397878 9:75892560-75892582 TCTGCCAGGGGGAAGGGAGAGGG + Intronic
1057949250 9:99356731-99356753 CCTGCCAGGGAGAGGGCAGCAGG + Intergenic
1059176863 9:112175604-112175626 ACCCCCGGGGAGAGGGGTGAGGG + Intergenic
1059656932 9:116365840-116365862 CCACACAGAGAGAGGAGAGAAGG - Intronic
1059758485 9:117316471-117316493 CCTCCCAGGGTGGGGAGCGATGG + Intronic
1060401651 9:123353196-123353218 GATGCCAGGGAGAGAGGAGATGG - Intergenic
1060732364 9:126046759-126046781 TCTCCCCAGGAGAGGGGAGGAGG - Intergenic
1060797424 9:126522212-126522234 CCTCCCAGGGAGAGAGGCGTGGG - Intergenic
1061297526 9:129685056-129685078 CAGCCCAGGGAGAGGGCAGGAGG - Intronic
1061675661 9:132214234-132214256 CCTCCCAGGGAGAGAGGAGCGGG - Intronic
1061902515 9:133680350-133680372 CCTCACAGGCAGGTGGGAGATGG - Intronic
1061907003 9:133703982-133704004 TCGCCCAGGGACAGGGGAGAGGG + Intronic
1061919398 9:133774452-133774474 GCTCCCAGGGAGAGGGCATAGGG + Intronic
1062082858 9:134633645-134633667 GTTTCCAGGGAGAGGGGAGACGG - Intergenic
1062103645 9:134740981-134741003 CCTTCCAGTGAGAGGGGTGCTGG + Intronic
1062161585 9:135083359-135083381 CCTGCCAGGGAGAGTGCGGAGGG + Intronic
1062175284 9:135158591-135158613 CCTCCTTGGGAGTGGGGAGATGG + Intergenic
1062208170 9:135348638-135348660 CCTGCCAGGGAGGGGGGGGCGGG - Intergenic
1062269734 9:135702923-135702945 CCTCCCAGGGATAGGCCAGCGGG - Intronic
1062284541 9:135767258-135767280 GGGCCCAGGGAGTGGGGAGAGGG + Intronic
1062546486 9:137065922-137065944 CTTCCCTGGGGGAGGGGTGACGG + Intronic
1203732039 Un_GL000216v2:99401-99423 TCTCTCTTGGAGAGGGGAGAAGG + Intergenic
1185945741 X:4374072-4374094 CCTTCCAGAGGGAGGCGAGACGG - Intergenic
1186896917 X:14012837-14012859 CCTCCCAGGCAGAGGGGCTATGG + Intronic
1188003560 X:25002799-25002821 GCTCCCAGGGTGATGGGAAAGGG - Intergenic
1188266348 X:28080694-28080716 CATGGCAGGGAGAGTGGAGAGGG - Intergenic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188637455 X:32452088-32452110 GCTCATAGGGAGAGGGAAGAGGG + Intronic
1189172379 X:38922227-38922249 GATCCCAGGGAGCAGGGAGATGG + Intergenic
1189313459 X:40036244-40036266 GTTCCCAGGGGCAGGGGAGAGGG - Intergenic
1189838245 X:45042250-45042272 CCGTGGAGGGAGAGGGGAGAGGG + Intronic
1190243632 X:48676653-48676675 CCGCCCGGGGCGAGGGGAGCCGG + Intronic
1190289683 X:48983948-48983970 TTTACCAGGGAGAAGGGAGATGG - Intronic
1190391445 X:49935697-49935719 CATCCCAGGCAGAGGAGACAAGG + Intronic
1191175020 X:57490314-57490336 CCTGTCAGGGAGTGGGGGGAGGG - Intergenic
1191883292 X:65863536-65863558 GGTCCCTGGGAGAGGTGAGATGG + Intergenic
1192031204 X:67514307-67514329 CCTGTCAGGGAGAGGGGGGCTGG + Intergenic
1192164832 X:68821515-68821537 GCTTCCATGGGGAGGGGAGAAGG + Intergenic
1192718600 X:73668994-73669016 CATCCCAGGGAGAGGTGGGGAGG + Intronic
1193590432 X:83382963-83382985 CCTCTCAGGGGGTGGGGAGCTGG + Intergenic
1194757098 X:97750087-97750109 CTTCCTAGGGGAAGGGGAGATGG + Intergenic
1196121014 X:112050710-112050732 CTTCTCAGGTAGAGGAGAGAAGG + Intronic
1196739829 X:119015050-119015072 GCTCCCTAGGAGAGTGGAGATGG + Intronic
1196820450 X:119696421-119696443 CTTCCCAAGAACAGGGGAGATGG + Intergenic
1197198858 X:123732045-123732067 CCTTCCAGGGGAAGGGGAGGAGG + Intronic
1198422857 X:136485102-136485124 CCTCTCAGGTGGTGGGGAGAGGG - Intergenic
1198903626 X:141537312-141537334 CCTGTCAGGGGGTGGGGAGAGGG - Intergenic
1199322490 X:146456389-146456411 TCTCCTAGGGAGGGGGGAAAGGG + Intergenic
1199459413 X:148068468-148068490 CCTGCCATGGGGTGGGGAGAGGG - Intergenic
1199579623 X:149348176-149348198 ACTTCCAAGGAGAGGTGAGATGG + Intergenic
1199644020 X:149887592-149887614 ACTCCCAGGGAGAGAGGACGAGG - Intergenic
1199713352 X:150488127-150488149 CTTCCCAGAGAGAAGGGGGAGGG - Intronic
1200051273 X:153433119-153433141 CCTCCCAGGGGCAGTGGGGAGGG + Intergenic
1200090817 X:153635136-153635158 CGTCCAAGCGAGAGGGGACAGGG + Intergenic
1200121726 X:153794245-153794267 CCTCCCAGGGACGGCAGAGAAGG + Exonic