ID: 1019912045

View in Genome Browser
Species Human (GRCh38)
Location 7:4106647-4106669
Sequence CTCTGAGAACGCCGGGCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019912045_1019912048 -6 Left 1019912045 7:4106647-4106669 CCGCACGCCCGGCGTTCTCAGAG 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1019912048 7:4106664-4106686 TCAGAGAAACCCGATGAGCCTGG 0: 1
1: 0
2: 1
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019912045 Original CRISPR CTCTGAGAACGCCGGGCGTG CGG (reversed) Intronic
901449201 1:9325856-9325878 CTCTGGGCACACCGGGCCTGAGG - Intronic
901499664 1:9644025-9644047 CTCTGAGCACCCAGGGAGTGGGG - Intergenic
901514433 1:9735489-9735511 GTCTGCGAATTCCGGGCGTGGGG + Exonic
908002536 1:59694589-59694611 CTCTGAGAAATCCTGGCCTGTGG - Intronic
923368650 1:233288375-233288397 CCCTGAGAAAGCTGGGAGTGGGG + Intronic
1065206037 10:23358540-23358562 CTCTGAGAACGCTGGCAGTTGGG + Intergenic
1073472710 10:103733058-103733080 CTCTGAGAATGGCGGGGGTGGGG - Intronic
1075791019 10:125084519-125084541 CTCTGGGAAGGGAGGGCGTGAGG + Intronic
1076683291 10:132186168-132186190 CCCGGAGGACGCCGGGCGTGGGG + Intergenic
1076716890 10:132370596-132370618 CTCACAGAGCGCCGGGCGGGTGG + Intronic
1091446612 12:547191-547213 CGCTGGGAAGGACGGGCGTGGGG + Intronic
1094703966 12:32896904-32896926 CTCAGGGAAGGCCGGGCGTCCGG - Intergenic
1110033187 13:70644208-70644230 CACTGAGAAAGTCGGGAGTGGGG - Intergenic
1125899069 15:43328877-43328899 CTGTGAGAATGCCGGGCTTCAGG + Exonic
1127488206 15:59438295-59438317 CTCTGGGAACCCCGGCCGGGCGG + Intronic
1129845083 15:78764475-78764497 CTCTCAGAACACAGGCCGTGGGG + Intronic
1130233369 15:82113387-82113409 CACTGAGAATGCCTGGCTTGAGG - Intergenic
1136288862 16:29259801-29259823 CCCTGAGAACGCCCTGCCTGGGG + Intergenic
1142094589 16:88232708-88232730 CCCTGAGAACGCCCTGCCTGGGG + Intergenic
1147540007 17:41349392-41349414 GTCTGAGAATGCCAGGCTTGTGG - Exonic
1147545332 17:41396959-41396981 GTCTGAGAATGCCAGGCTTGTGG - Exonic
1148471538 17:47896524-47896546 CTCGGAGCCCGCCGGGCGGGAGG + Intronic
1152668923 17:81589752-81589774 CTCTGAGAGGGCAGGGCGGGAGG + Intronic
1160994559 19:1876676-1876698 CGATGAGGACGCCAGGCGTGGGG - Intergenic
1161723264 19:5915128-5915150 CTCTGAGAAGGACGGGCAGGTGG + Exonic
1165160215 19:33811581-33811603 CTCCGCGGACGCCGGGGGTGCGG - Intronic
1166043636 19:40217379-40217401 CTCTGAGAGTGCCGGCCGCGGGG - Intronic
1166378981 19:42344649-42344671 CTCTGAGAAGACAGGGGGTGGGG - Exonic
925780130 2:7374527-7374549 CTCTGACAATGCAGGGAGTGGGG - Intergenic
930209275 2:48617750-48617772 CACGGAGAACGCCGGGGGCGTGG - Intronic
931629480 2:64285980-64286002 GTCTGAGAACACCTGGGGTGGGG - Intergenic
934534459 2:95121683-95121705 CTCTGAGCGGGCCGGGAGTGGGG - Intronic
942556598 2:177178231-177178253 CTCTGAGAACGGCTGGGTTGAGG + Intergenic
946031869 2:216711801-216711823 GTCTGAGAACTCTGGGGGTGAGG - Intergenic
1170104289 20:12736960-12736982 CTCTGAGAAGGTCGGGGGTGGGG - Intergenic
1175948865 20:62571841-62571863 CTGTGAGAAGGCGGGGCCTGTGG + Intergenic
1176159368 20:63640745-63640767 CTCTGAGACCACCTGGCGTGAGG - Exonic
1178108034 21:29342737-29342759 CTCTGAGCAAGCTGGGCCTGCGG + Exonic
1180055615 21:45357823-45357845 CCCTGAGAGTGCCCGGCGTGTGG - Intergenic
1180065883 21:45412061-45412083 CTCTGGGAATGCCGGGTTTGTGG + Intronic
1180122468 21:45763075-45763097 CTCTTAGAAGGCCGGACGTTTGG + Intronic
1181778880 22:25178717-25178739 CTCTGAGACCACCCGGCCTGAGG - Intronic
956178950 3:66500421-66500443 CGCTGCGAACTCCGGGCGCGGGG + Exonic
961816612 3:129553982-129554004 CTCTGAGAACGCCAGCCGCACGG - Intergenic
962968821 3:140380170-140380192 CTCTGACAACACTGGGCTTGAGG + Intronic
977244828 4:94619146-94619168 CTGTGAGAATGTGGGGCGTGGGG - Intronic
978463175 4:108980187-108980209 CTCTGAGAACACGGGGTGTTCGG + Intronic
1002938856 6:1698669-1698691 CTCTGAGAAGGGCAGGCATGGGG + Intronic
1011643175 6:89433547-89433569 CTCCGAAAACGCCCGGCGCGAGG + Intronic
1013610240 6:111787972-111787994 CTCTGAGAAGGCAAGGCATGAGG - Intronic
1017124555 6:151052951-151052973 CACTGAGATCGCCCGTCGTGGGG + Intronic
1018170239 6:161138725-161138747 CTCAGAGGACGCCAGGCTTGGGG + Intronic
1019824709 7:3274536-3274558 CTCTGAGAACAAATGGCGTGGGG + Intergenic
1019912045 7:4106647-4106669 CTCTGAGAACGCCGGGCGTGCGG - Intronic
1020055802 7:5117001-5117023 CCCTCAGAAGGCTGGGCGTGGGG + Intergenic
1023936563 7:44744206-44744228 CTCAGAGAACGTCAGGCCTGGGG - Intergenic
1024561038 7:50645608-50645630 GTCTGAGAACTCCGGGCGATTGG - Intronic
1025888478 7:65621947-65621969 CACTGAGAATGCTGGGCTTGGGG + Intergenic
1029111900 7:98217036-98217058 CTCCGGGAACGCCGGCCCTGGGG - Exonic
1031853964 7:126900015-126900037 CACTGAGAATGCTGGGCTTGGGG - Intronic
1035157774 7:156928308-156928330 CTCTAGGAACGCCGGGCTGGAGG + Intergenic
1039836181 8:41258250-41258272 CTCTGAGATCCCCGGGTGTCAGG - Intergenic
1043244782 8:77984019-77984041 CTCTGACATGGCCGGGGGTGGGG - Intergenic
1057030202 9:91769453-91769475 CCCTGAGCACGCAGGGCATGTGG + Intronic
1185734825 X:2488757-2488779 GTATGAGAACGCCCGGAGTGGGG - Exonic