ID: 1019914394

View in Genome Browser
Species Human (GRCh38)
Location 7:4123463-4123485
Sequence GGGAGCTCTGTGCAGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019914386_1019914394 14 Left 1019914386 7:4123426-4123448 CCTGGTAACAGCCATGGTGGCAT 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1019914394 7:4123463-4123485 GGGAGCTCTGTGCAGGCCCAGGG No data
1019914383_1019914394 20 Left 1019914383 7:4123420-4123442 CCATTTCCTGGTAACAGCCATGG 0: 1
1: 0
2: 2
3: 17
4: 209
Right 1019914394 7:4123463-4123485 GGGAGCTCTGTGCAGGCCCAGGG No data
1019914387_1019914394 3 Left 1019914387 7:4123437-4123459 CCATGGTGGCATTTAAGACACCC 0: 1
1: 0
2: 1
3: 5
4: 105
Right 1019914394 7:4123463-4123485 GGGAGCTCTGTGCAGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019914394 Original CRISPR GGGAGCTCTGTGCAGGCCCA GGG Intronic
No off target data available for this crispr