ID: 1019917116

View in Genome Browser
Species Human (GRCh38)
Location 7:4140636-4140658
Sequence CACAGTAAACAGGGCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 388}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019917116_1019917131 29 Left 1019917116 7:4140636-4140658 CCAGCCCTGCCCTGTTTACTGTG 0: 1
1: 0
2: 4
3: 44
4: 388
Right 1019917131 7:4140688-4140710 TGCAAATGTGAAATGGAAACAGG No data
1019917116_1019917129 22 Left 1019917116 7:4140636-4140658 CCAGCCCTGCCCTGTTTACTGTG 0: 1
1: 0
2: 4
3: 44
4: 388
Right 1019917129 7:4140681-4140703 CCTTGCCTGCAAATGTGAAATGG 0: 1
1: 0
2: 2
3: 6
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019917116 Original CRISPR CACAGTAAACAGGGCAGGGC TGG (reversed) Intronic
900173686 1:1282509-1282531 CACAGTAGACAGGGATGGGGTGG + Intronic
900316954 1:2061677-2061699 ATCAGCACACAGGGCAGGGCAGG - Intronic
901288403 1:8101503-8101525 AAGAGTTAACATGGCAGGGCTGG - Intergenic
902590314 1:17469327-17469349 CACAGTGTACAGGACAGGGAAGG + Intergenic
903029938 1:20456685-20456707 CAGGGTAAATAGGGCAGGGATGG + Intergenic
903266378 1:22160454-22160476 GACAATAAAAAGGGCAGGGAAGG - Intergenic
903687459 1:25142434-25142456 CAGAGTAGACATGGAAGGGCAGG - Intergenic
903888555 1:26555229-26555251 CATTGTTATCAGGGCAGGGCTGG - Intronic
904001891 1:27343374-27343396 TCCAGGCAACAGGGCAGGGCTGG + Intronic
904186301 1:28707749-28707771 TACAGGAAAGAGGTCAGGGCTGG + Intronic
904846799 1:33425770-33425792 CACAGTTTACATGGCTGGGCTGG - Intronic
905129880 1:35746339-35746361 CACAGAAAACAGGGCTGTGATGG - Intronic
905304089 1:37005605-37005627 CACAATAAAGACGGGAGGGCTGG + Intronic
905645083 1:39619674-39619696 GACAGTCAACAGGACAGGGAAGG + Intergenic
906178026 1:43792687-43792709 CACTGTAAACAGGGAAGAGAAGG - Intronic
907398748 1:54210997-54211019 CACAAGAAACAGGGCAGGCAGGG - Intronic
909247860 1:73311229-73311251 CACAGTAAACAGCTCAAGTCAGG - Intergenic
909406141 1:75291714-75291736 CACAGAAAGCAGGGTAGGCCGGG + Intronic
909451738 1:75805119-75805141 AAAAATAAACAGGTCAGGGCTGG - Intronic
910248794 1:85171906-85171928 CACAGAGAAGAGGGGAGGGCGGG + Intronic
910881907 1:91929437-91929459 CAGGGAAAACAGGGCAGGGCTGG + Intergenic
911056828 1:93715959-93715981 CAAAGTAAACTTGGCAGGGTTGG - Intronic
912102056 1:106221684-106221706 CACAATAAACATGGGAGTGCAGG - Intergenic
913117551 1:115711084-115711106 GACAGATAGCAGGGCAGGGCAGG - Intronic
916211777 1:162365582-162365604 CAGAGGAAGCAGGGCTGGGCAGG - Intronic
916321556 1:163510473-163510495 CACAGTACAGATGGCAGAGCAGG + Intergenic
916711643 1:167415803-167415825 CACAGTGAGCTGGGCAGAGCTGG + Exonic
918042542 1:180921992-180922014 CACAGCAATCAGGGCAACGCTGG + Intronic
918108260 1:181431976-181431998 CACACTAAAGATGGCAGGGTGGG - Intronic
918121832 1:181547150-181547172 CACAGAGAACAGGGCAGAGGGGG - Intronic
918389543 1:184043991-184044013 TACAATGAACAGGGCATGGCTGG + Intergenic
919749908 1:201031009-201031031 AACAGCAACCAGGCCAGGGCAGG - Intergenic
919767676 1:201137891-201137913 CACAGTGAACAGGGAAGGCATGG - Intronic
921763729 1:218946253-218946275 CACAGAAAACAGGACACAGCAGG - Intergenic
922551217 1:226495866-226495888 CCCAGTGACCAGGGCGGGGCAGG + Intergenic
923044486 1:230345488-230345510 CTCTGCAAACAGGGTAGGGCTGG + Intronic
923128907 1:231057691-231057713 CACAGTAAACAGCACATAGCAGG + Intergenic
923890786 1:238213284-238213306 CACAATCAAAAGGGCAGTGCAGG - Intergenic
1063354506 10:5385502-5385524 CACAGTAAAGAGGGCAGACTCGG - Intergenic
1063965667 10:11344211-11344233 CCCAGGACACGGGGCAGGGCTGG + Intergenic
1064785235 10:18887788-18887810 TACAGGATGCAGGGCAGGGCAGG - Intergenic
1066392114 10:34985930-34985952 CCCAGTGTACAGGGCTGGGCAGG + Intergenic
1069748555 10:70731556-70731578 CACAGGAATCATGGCAGTGCAGG - Intronic
1070269133 10:74934940-74934962 AACAGTAACCAGGACAGGGAAGG - Intronic
1070804525 10:79263350-79263372 CACTGTAAGCAGGGAAGGGTGGG + Intronic
1071861437 10:89677425-89677447 CACATTAAAGATGGCAGAGCAGG - Intergenic
1071996235 10:91152498-91152520 CCCACTAAACAGGACAGGGAGGG - Intergenic
1073198269 10:101713332-101713354 TTCAGTGAACAGGGCAGGGGCGG + Intergenic
1073488997 10:103840165-103840187 TAAACTGAACAGGGCAGGGCGGG + Intronic
1075219580 10:120572893-120572915 CACAGTATCTAGAGCAGGGCTGG + Intronic
1076165732 10:128281076-128281098 CAGAGGAAATGGGGCAGGGCAGG + Intergenic
1076430097 10:130395685-130395707 AACAGCAAACAGGGGAGGTCGGG + Intergenic
1076843376 10:133057355-133057377 CACAGGGAGGAGGGCAGGGCAGG + Intergenic
1077101807 11:825800-825822 GCCAGTACACAGGGCAGGGCTGG + Intergenic
1077248299 11:1549601-1549623 CGCAGGGCACAGGGCAGGGCGGG - Intergenic
1077303307 11:1856878-1856900 CTCAGGAAAGAGGGCAGAGCTGG + Intronic
1077829856 11:5855271-5855293 CTCAGTAGACAAGGTAGGGCCGG - Intronic
1078397146 11:10991300-10991322 CAAAGTCAATTGGGCAGGGCTGG + Intergenic
1079015625 11:16866289-16866311 CTCAGTAAAGAGGGCAGAGCAGG + Intronic
1079102492 11:17550697-17550719 CACAGGAAATAGGAGAGGGCAGG - Intronic
1080516130 11:33022165-33022187 CACAGTACACAGGGTAAGACAGG - Intronic
1081673592 11:44955451-44955473 CACAGGAAGCAGGAAAGGGCTGG - Intergenic
1081719664 11:45278907-45278929 CACAGTAAACATGTTTGGGCTGG - Intronic
1082010578 11:47447528-47447550 CACAGCAAACATGGCAGTGCAGG + Intronic
1083222785 11:61264509-61264531 CCCAGGAAGCAGGGCAGGGTCGG + Exonic
1083261260 11:61524312-61524334 GACAGGCAGCAGGGCAGGGCTGG - Intronic
1083548292 11:63565129-63565151 GACAGAGAACAGGGTAGGGCAGG + Intergenic
1083664708 11:64268208-64268230 CACAGGAAGCGGGGCAGGGAAGG - Intronic
1084022734 11:66427396-66427418 CAGAGAAAACAGCCCAGGGCTGG - Intergenic
1084066719 11:66708436-66708458 AACAGGAAACAGGGCAGCGCTGG + Intronic
1085128980 11:74021524-74021546 CCCAGCAAACAAGGCAGAGCGGG + Intronic
1085288587 11:75380895-75380917 CCCAGAGAACAGGGCAGGTCGGG + Intergenic
1085422068 11:76371288-76371310 CTGAGTAAACAGCGCAGGGAAGG - Intronic
1085654657 11:78302240-78302262 CAGAGTAAACAGGCCAGAGTGGG + Intronic
1085778072 11:79383827-79383849 CACAGAAAGCAGGGCAGGTTTGG - Intronic
1085977599 11:81678322-81678344 CACAATAAACAGAGAAGTGCAGG + Intergenic
1088597128 11:111449172-111449194 AGCAATAAACAGGGCAGGGGAGG - Intronic
1089155661 11:116400304-116400326 CACAGTCAGCAGGGCACTGCAGG + Intergenic
1090248491 11:125234927-125234949 CTCAGGAAAAAGGCCAGGGCTGG - Intronic
1090805012 11:130197509-130197531 CCCAGCACACAGGGCAGGGCAGG + Intronic
1090842648 11:130506356-130506378 TACAGGAGACAGGGCAGGGGAGG - Intergenic
1090845831 11:130529026-130529048 GACAGAAGACAGGACAGGGCAGG - Intergenic
1091208598 11:133837321-133837343 CACAGGAAACAGTGCTGGGCAGG + Intergenic
1091595722 12:1877881-1877903 CACAGTGAAGAGGGCTGGGAGGG + Intronic
1091781062 12:3214949-3214971 CACAGTGAACAGGGTAGAGCCGG - Intronic
1092218493 12:6698132-6698154 GGAAGTACACAGGGCAGGGCTGG - Intronic
1092262689 12:6960973-6960995 CCAAGGACACAGGGCAGGGCAGG - Intronic
1094503307 12:31039079-31039101 CACTGTAAAGAGGTCAGTGCAGG + Intergenic
1095244614 12:39904455-39904477 AACAGTTAACATGGCAGGCCTGG - Intronic
1095351390 12:41217751-41217773 CACAGTAAGCAGGCCAAGGATGG - Intronic
1096458582 12:51808179-51808201 TACAGTGAACGGTGCAGGGCTGG - Exonic
1096762592 12:53854798-53854820 CACAGTGAACAGTGGAGGGTGGG + Intergenic
1098488406 12:71047657-71047679 CACAGGAGGGAGGGCAGGGCAGG + Exonic
1099632437 12:85167661-85167683 GTCAGTAAACAGGGAAAGGCAGG - Intronic
1100397669 12:94199020-94199042 CAGAGTAAACAGGGCTGTGAAGG + Intronic
1101715535 12:107308998-107309020 CAAAGTAGGCAAGGCAGGGCAGG - Intergenic
1102030921 12:109739685-109739707 CCCAGTCAACTGGGCAGGGAGGG - Intronic
1102354343 12:112220373-112220395 CACAGTAAAGAGCACAGTGCTGG + Intronic
1103332624 12:120164708-120164730 CACAGTACACAGGGCTTGGAGGG + Exonic
1103534819 12:121627066-121627088 GACAGTAGAGGGGGCAGGGCAGG - Intronic
1103994583 12:124820777-124820799 CACAGAAAACAGTGGGGGGCAGG + Intronic
1104566268 12:129887223-129887245 CACGGTAGACAGGGAGGGGCGGG - Intronic
1105472727 13:20706658-20706680 CTCAGGAGACAGAGCAGGGCTGG + Intronic
1105936910 13:25109011-25109033 TGCAGTAAACATGGGAGGGCAGG + Intergenic
1106119642 13:26849416-26849438 CCAAGTAAACAGGGCATCGCTGG + Intergenic
1106421529 13:29589730-29589752 CAGTGTACACAGGGCAGGCCAGG + Intronic
1108316526 13:49242490-49242512 CACAGGATAGGGGGCAGGGCGGG - Intergenic
1108490458 13:50976305-50976327 CACAGTAAAGAGGGCAGAGATGG - Intergenic
1110191838 13:72739396-72739418 CACAGTAAACAGCACAGCTCTGG - Intronic
1111837095 13:93401305-93401327 GACAGTCAACAAGGGAGGGCAGG + Intronic
1112413121 13:99180575-99180597 CACAGTTAGCAGGACAGAGCGGG - Intergenic
1113608846 13:111629088-111629110 CACAGGAAAGTGGGCAGGGTGGG + Intronic
1113714178 13:112491489-112491511 AACAGTAAACATGGCAGGAAGGG - Intronic
1113748958 13:112765341-112765363 ACCAGAAAACAAGGCAGGGCGGG - Intronic
1114672354 14:24418026-24418048 CACAGCTCTCAGGGCAGGGCTGG + Exonic
1114770438 14:25424983-25425005 CCTACAAAACAGGGCAGGGCAGG - Intergenic
1115238551 14:31232221-31232243 CACACCCAACTGGGCAGGGCTGG + Intergenic
1115738457 14:36361252-36361274 GAGAGTAAAGAGAGCAGGGCAGG - Intergenic
1118364728 14:65084958-65084980 CACATTAAATGGGGCAGGGGGGG + Intronic
1118760451 14:68877845-68877867 CACACTAATGACGGCAGGGCTGG + Intronic
1118892705 14:69923239-69923261 CACAGTAAAGAGGGCTGAGCCGG - Intronic
1119453533 14:74733950-74733972 CACAGTAAGTAGCGAAGGGCAGG - Intronic
1120360226 14:83491265-83491287 CACAGTGAAAGGGGCAAGGCAGG + Intergenic
1123764634 15:23466192-23466214 ATTAGTAAACTGGGCAGGGCAGG - Intergenic
1124512195 15:30336826-30336848 CACAGGACTCAGGCCAGGGCAGG + Intergenic
1124730719 15:32193925-32193947 CACAGGACTCAGGCCAGGGCAGG - Intergenic
1127762353 15:62151638-62151660 CCCAGTAAGCAGGGCAGGGGAGG - Intergenic
1128635082 15:69298083-69298105 CTCAGCAAACAAGGCAAGGCAGG + Intergenic
1129064284 15:72888406-72888428 CAGAGGCAACAGGGCTGGGCTGG - Intergenic
1129255829 15:74333426-74333448 CACAGAATATTGGGCAGGGCAGG + Intronic
1129314786 15:74735119-74735141 CACAGTAATCAGGGGAGATCAGG + Intergenic
1129456870 15:75680794-75680816 AACACTAAACTGGGCAGGGAAGG - Intronic
1130185453 15:81677191-81677213 GACAGAGAACAGGGAAGGGCAGG + Intergenic
1130216988 15:81981265-81981287 CAAAATAAACAGGCCAGGCCCGG - Intergenic
1130222254 15:82029510-82029532 CAAAGTAAGCAGATCAGGGCTGG - Intergenic
1132321618 15:100929735-100929757 CACAGGAAACAGGGCAGGCAGGG + Intronic
1132489152 16:215988-216010 AACAGTAAACCGGGCTGGGCAGG - Intronic
1132633943 16:933744-933766 CCCAGTGGACAGGACAGGGCCGG - Intronic
1132636438 16:952128-952150 CAGTGTCACCAGGGCAGGGCAGG - Intronic
1132666439 16:1083223-1083245 CTCAGGAAACAGGCCCGGGCAGG + Intergenic
1133238723 16:4402546-4402568 CACAGTTCACAGGGCTGGGCGGG - Intronic
1133401499 16:5490611-5490633 CAGAGGAACCAAGGCAGGGCTGG - Intergenic
1134544955 16:15101162-15101184 CACGGTGTACAGGACAGGGCAGG + Intronic
1135362589 16:21827880-21827902 CACAGTGTACAGGACAGGGCAGG + Intergenic
1135995041 16:27241406-27241428 CACTGAGGACAGGGCAGGGCAGG + Intronic
1136248268 16:28987468-28987490 CAAAGGAAACAGGGCAGTGCAGG - Intronic
1136706411 16:32191520-32191542 CACAGTAGAAAACGCAGGGCCGG + Intergenic
1136761498 16:32737897-32737919 CACAGTAGAAAACGCAGGGCCGG - Intergenic
1136806604 16:33132493-33132515 CACAGTAGAAAACGCAGGGCCGG + Intergenic
1137483496 16:48872172-48872194 GCCACTAAACAGGGCAGGGAGGG - Intergenic
1137570891 16:49565698-49565720 CTCCGTGAACAGGGGAGGGCAGG + Intronic
1137586477 16:49666877-49666899 CCCAGAAAAAAGGGCAGGGTGGG + Intronic
1137629285 16:49930930-49930952 CACATGAATCAGGGCAGGGCTGG + Intergenic
1138339684 16:56280567-56280589 CAGAGTGGACAGGGCAGGGAGGG + Intronic
1138575908 16:57907211-57907233 GAGAGTAAGCAGAGCAGGGCAGG - Intronic
1141049259 16:80745856-80745878 CCCAGAAGACAGGGAAGGGCAGG + Intronic
1141231254 16:82169957-82169979 CCCAGTAAACAGTGCAGAGCAGG + Intronic
1141278140 16:82606500-82606522 CACAGGCAGCAGGGAAGGGCAGG - Intergenic
1141428437 16:83958176-83958198 CACTGTAAAGAGGCCAGGCCTGG - Intronic
1203063653 16_KI270728v1_random:998212-998234 CACAGTAGAAAACGCAGGGCCGG - Intergenic
1142614006 17:1124702-1124724 CAGAGTGAACAGAGGAGGGCTGG + Intronic
1142849393 17:2696949-2696971 CAGAGGAAACAGGGCAGAGCAGG + Intronic
1143846832 17:9778598-9778620 CACAGCAAACAGGCCAGCACCGG - Intronic
1144194195 17:12874902-12874924 CAGAGTATATCGGGCAGGGCAGG + Intronic
1144502601 17:15802183-15802205 AACAGTGAACAGGACAGGCCTGG + Intergenic
1145164778 17:20604837-20604859 AACAGTGAACAGGACAGGCCTGG + Intergenic
1145976572 17:28987354-28987376 CACAGTACAGAGGGCAGGGCTGG - Intronic
1146933817 17:36797539-36797561 CACAGCTGACAGGCCAGGGCTGG - Intergenic
1147360854 17:39928641-39928663 CACTCTATGCAGGGCAGGGCTGG + Intergenic
1147587396 17:41660288-41660310 CACAGTGAGCAGGGAAGGGGAGG + Intergenic
1147964936 17:44189492-44189514 CACAGTGATGAGGCCAGGGCTGG - Exonic
1148072995 17:44919558-44919580 CACAGCAAACAGAGAAGGGTAGG + Intergenic
1148148133 17:45378939-45378961 CCCAGCAGGCAGGGCAGGGCCGG - Intergenic
1148741048 17:49892884-49892906 CACAGGGAAGGGGGCAGGGCTGG + Intergenic
1148919583 17:51018831-51018853 CAGAGTGGACATGGCAGGGCTGG - Intronic
1149493945 17:57105343-57105365 GACAGTCAACAGGGTAGAGCTGG - Intronic
1149679135 17:58492462-58492484 GACAAAAAACAGGGCAGGCCAGG - Intronic
1150299979 17:64039803-64039825 CACAGTACACAGGGGAGGTGGGG + Exonic
1151544118 17:74781849-74781871 CACAGCAAGCCGGGCAGGGGTGG - Intronic
1151642777 17:75408188-75408210 CACAGAGAACAGGGAAGGGCAGG + Intergenic
1152375215 17:79915395-79915417 CACAGTGGACAGAGCAGAGCTGG + Intergenic
1152705729 17:81842727-81842749 CACACGATAAAGGGCAGGGCTGG - Intergenic
1152807457 17:82362948-82362970 AACAGGACACAGGGCAGAGCTGG + Exonic
1153761965 18:8340096-8340118 CACAGTGACCAGGCCAGGGAGGG + Intronic
1154018007 18:10637512-10637534 CACAGTACACAGAGCTTGGCTGG - Intergenic
1155070841 18:22314630-22314652 CAAAGAAATCGGGGCAGGGCCGG - Intergenic
1156078313 18:33306996-33307018 CACAGTCCACAGGGCTGGGGAGG - Intronic
1156211846 18:34952915-34952937 CACAGTAGAAAGGGCAGGCTTGG - Intergenic
1156651701 18:39233699-39233721 CACAGTATGGGGGGCAGGGCAGG + Intergenic
1157480950 18:48053376-48053398 CACAGTAAACAGGTGATGGAAGG + Intronic
1157978046 18:52348884-52348906 CACAATAAACAGGATAAGGCAGG - Intronic
1158159560 18:54465576-54465598 CACAAGATAGAGGGCAGGGCAGG + Intergenic
1159159947 18:64631395-64631417 CACAGGAGTCAGGCCAGGGCAGG - Intergenic
1160566885 18:79791528-79791550 CACAGCACACGGTGCAGGGCTGG + Intergenic
1161326807 19:3668039-3668061 CCCAGGAGCCAGGGCAGGGCTGG - Intronic
1161719311 19:5894421-5894443 CCCAGTTCCCAGGGCAGGGCAGG - Intronic
1161994966 19:7706370-7706392 CAAAGTCAACAGTGCAGGGTGGG - Intergenic
1162034011 19:7929565-7929587 CACAGAAACCAGGGCAGTGCTGG - Intronic
1162175509 19:8827164-8827186 CACTGTATCCAGGGCAGGGCAGG - Intronic
1163204966 19:15795620-15795642 TACAGTAAAAAAGTCAGGGCTGG - Intergenic
1163719379 19:18891443-18891465 CAGAGAATGCAGGGCAGGGCCGG - Intronic
1163770593 19:19188784-19188806 AAGGGGAAACAGGGCAGGGCTGG - Intronic
1164443563 19:28298638-28298660 CAGAGAACACAGGGAAGGGCAGG + Intergenic
1165095211 19:33406488-33406510 CAGAGTGCTCAGGGCAGGGCTGG + Intronic
1165170571 19:33889040-33889062 AACAGTCAAAAGGGCAGGGTTGG + Intergenic
1166159609 19:40942035-40942057 CACAGTAGGGAGGGGAGGGCAGG - Intergenic
1168122497 19:54259725-54259747 CACAGTCAACATGGCTGGGAAGG + Intronic
1168450515 19:56462856-56462878 AAGAATAAACAGGCCAGGGCAGG + Intronic
1168514571 19:57000806-57000828 CACACTCACCTGGGCAGGGCAGG - Intergenic
1168559540 19:57371452-57371474 CAAGGGAAACAAGGCAGGGCTGG + Intronic
1168687963 19:58359550-58359572 CCAAGGAGACAGGGCAGGGCAGG - Intronic
925338362 2:3115171-3115193 CAAAGGAGACTGGGCAGGGCAGG + Intergenic
925342684 2:3148035-3148057 CACAGTAGTCAGTGCAGAGCAGG + Intergenic
925971179 2:9107695-9107717 CACGGAAAACAGGCCAGGGCAGG + Intergenic
927562578 2:24084332-24084354 CTGAGGACACAGGGCAGGGCAGG + Exonic
927843760 2:26461054-26461076 CAGAGTGAACAGGGCTGGGGTGG + Intronic
928252554 2:29694741-29694763 CAAAGTAAACAGAGCAGAACAGG + Intronic
928914574 2:36457433-36457455 CACTGTACACAGGGGAGGGATGG + Intronic
934942075 2:98510019-98510041 AACAGCAAAGAGGCCAGGGCAGG + Intronic
937039125 2:118807563-118807585 CTCAGTAAACGGGGCAGGCGGGG + Intergenic
937256450 2:120559334-120559356 CTCAGGAAACAGTGCAGGGTTGG + Intergenic
937391671 2:121494140-121494162 TGCAGTAAACATGGCAGTGCAGG - Intronic
937435148 2:121874009-121874031 CAGAGCAAAAAGGGCAGGGAGGG - Intergenic
937858731 2:126691629-126691651 CCCAGAAAACAGGGCAGAGCTGG - Intronic
937859237 2:126695216-126695238 CCCAGAAAACAGGGCAGAGCTGG - Intronic
939143944 2:138390057-138390079 TAAAGTAGACAGGGCAGGGGTGG - Intergenic
941656840 2:168153599-168153621 TAAAGAAAACAGAGCAGGGCAGG + Intronic
942481792 2:176395801-176395823 CTGAGAAAACAGGGCAGGGGAGG + Intergenic
944381342 2:199114266-199114288 CACAATAAATAAGGCATGGCTGG - Intergenic
946153201 2:217789885-217789907 CCAGGTAAACAGGGCAGGCCGGG - Intergenic
946170154 2:217890447-217890469 GGCAGGAAACAGGGCAGGGATGG - Intronic
946658118 2:221970686-221970708 CACAGGAATCCCGGCAGGGCAGG - Intergenic
948574725 2:238942328-238942350 CACAGTGAACGGGCCAGAGCAGG + Intergenic
948576189 2:238951038-238951060 CTCTGTGAACTGGGCAGGGCAGG + Intergenic
1170000059 20:11605670-11605692 AACAGAAAACAGGGCAGGGTAGG + Intergenic
1170475974 20:16714887-16714909 AACAGCAAACAGGGCAGGTTCGG + Intergenic
1170647931 20:18213296-18213318 CAGAGAACTCAGGGCAGGGCAGG - Intergenic
1172031497 20:31985181-31985203 CAGAGTGAACAGGGTGGGGCTGG - Intronic
1172689764 20:36782359-36782381 CACAGCAAACAGGACAGAGTTGG + Exonic
1172846130 20:37930896-37930918 CGCAGGCAACAGGGCAGGGCAGG + Intronic
1173277099 20:41594880-41594902 CACACTGAGCAGGGTAGGGCAGG - Intronic
1173659911 20:44726011-44726033 CACAGCAAAAAGGGGATGGCGGG - Intronic
1173885404 20:46453280-46453302 CACAGGAAACTGGAAAGGGCAGG - Intergenic
1174181227 20:48676287-48676309 CACAGTGAGCAGGGCAGGGCGGG + Intronic
1174358987 20:50016131-50016153 CACCCTAGACAGGGCAGGGGCGG - Intergenic
1174488251 20:50874594-50874616 CTCAGTGCACAGGACAGGGCTGG + Intronic
1175025110 20:55893767-55893789 CAGAGTAAAGAGGGCAGTGTGGG - Intergenic
1175758674 20:61546567-61546589 CCCAGAAATCAGGGCAGGGAGGG + Intronic
1176080047 20:63267903-63267925 CCCAGACAACGGGGCAGGGCAGG + Intronic
1177852807 21:26368852-26368874 CACACTAAAGATGGCAGAGCTGG + Intergenic
1178122352 21:29482104-29482126 CTCAGAAACCAGGCCAGGGCAGG - Intronic
1178164920 21:29962359-29962381 CACAGGAAACAGGGAAGTACAGG - Intergenic
1180014123 21:45071919-45071941 CACAGTGAACAGGGGATGGATGG + Intergenic
1180968858 22:19804382-19804404 CCCAAGAAGCAGGGCAGGGCTGG + Intronic
1181044147 22:20206748-20206770 CACGGTACCCAGGGCAGGGCTGG + Intergenic
1181499048 22:23305488-23305510 CAAAGCAAGCAGGGCAGTGCTGG + Intronic
1181559756 22:23693227-23693249 GACAGAAAGCAGGGCAGGGCAGG + Intronic
1181721336 22:24777018-24777040 CAAAGAAAACAGGACAGGGCTGG + Intergenic
1181751191 22:24990379-24990401 GACAGTAAACAGGCCAGGCAAGG - Intronic
1182887815 22:33790268-33790290 CACAGTTCACATGGCTGGGCAGG - Intronic
1183205247 22:36414348-36414370 GAAAGGATACAGGGCAGGGCTGG + Intergenic
1183378786 22:37480359-37480381 CACAGAATACAGAGCAAGGCTGG + Intronic
1183989550 22:41589074-41589096 CACAGCAAACAGGCTAGGCCTGG + Intronic
1184381179 22:44145666-44145688 CACAGTCCACAAGGCAGGGAGGG - Intronic
1184402215 22:44280774-44280796 ATCTGTAAACTGGGCAGGGCTGG - Intronic
1184442055 22:44523010-44523032 CCCAGGAAGCAGGGCAAGGCAGG - Intergenic
1185035571 22:48474996-48475018 CACAGCAAGCTGGGCAGGACAGG + Intergenic
1185241316 22:49749105-49749127 CACAGCACACAGGGCAGAGCTGG + Intergenic
949242922 3:1892568-1892590 CACACTGAGCAGGGTAGGGCAGG - Intergenic
949536805 3:5002599-5002621 TCCAGTAAACAGGCCAGGGCTGG - Intergenic
950163945 3:10779715-10779737 AGCAGAGAACAGGGCAGGGCTGG - Intergenic
950227425 3:11247376-11247398 CACACTGAGCAGGGTAGGGCAGG + Intronic
950228383 3:11254843-11254865 CACACCAAGCAGGGTAGGGCAGG + Intronic
950503511 3:13378739-13378761 TACACCAAACAGGGAAGGGCTGG + Intronic
950638229 3:14331020-14331042 CACAGCTAAGAGGGCAGAGCTGG - Intergenic
950661413 3:14469150-14469172 CCAAGTAAACTGTGCAGGGCCGG - Intronic
950851368 3:16064903-16064925 CCCAGCAAAAAGGGCAGAGCAGG - Intergenic
952644363 3:35638737-35638759 CACAGAAACCTGGGCAGGGTAGG - Intergenic
952693681 3:36240152-36240174 CAAAGTAAACGGGGCAGGGATGG + Intergenic
954019017 3:47722139-47722161 CACACTTAACAGGACAGGACAGG - Intronic
954294857 3:49668605-49668627 CACAGTAAACAGAGGCGGGCTGG - Exonic
954759185 3:52861730-52861752 CACAGAAACCAGGACAGGGATGG - Intronic
954910390 3:54101947-54101969 CACAGGAAACATGGCTGGGAAGG - Intergenic
956210317 3:66795676-66795698 CAGATTACCCAGGGCAGGGCAGG - Intergenic
958932175 3:100219117-100219139 TACAGTAGACAGGTCAGGGAAGG + Intergenic
959476651 3:106820916-106820938 CCGAGTCAGCAGGGCAGGGCAGG + Intergenic
960534563 3:118802313-118802335 CAGAGTAATCAGGGCTGGGAGGG + Intergenic
966861218 3:184231708-184231730 CACAGCACACAGCACAGGGCTGG - Intronic
967653052 3:192010038-192010060 CACAGAAAGCAGATCAGGGCTGG + Intergenic
967977590 3:195044191-195044213 CACAGAAAACAGAGCAGAGAAGG - Intergenic
968244855 3:197134656-197134678 CTCAGAAAACTGGGAAGGGCAGG - Intronic
968456120 4:700894-700916 CAGAGTCCACAGGGCAGGGACGG - Intergenic
968855701 4:3120030-3120052 CACAGTGCACAGGTCAGGTCTGG - Intronic
968865623 4:3209486-3209508 CCCAGCAACCAGGGCAGGGCAGG - Intronic
969817157 4:9695273-9695295 CATGGGAAACAGTGCAGGGCGGG + Intergenic
970020775 4:11565905-11565927 TATAGTAAATAGGGAAGGGCAGG + Intergenic
971203555 4:24537265-24537287 CACAGAGCATAGGGCAGGGCAGG + Intronic
973296274 4:48524650-48524672 CACAGTAATCAGGGGTGGGGTGG - Intronic
974431649 4:61805230-61805252 CACAGGAAACAGGCCAGGCGCGG - Intronic
975344167 4:73275082-73275104 CATAGTGAACAGATCAGGGCAGG - Intergenic
978106079 4:104903494-104903516 CTCAGTAAACTGGAAAGGGCTGG + Intergenic
978324362 4:107535383-107535405 CACATTAAACATGGCAGAGGAGG - Intergenic
979268093 4:118726693-118726715 CACAGAGAACTGTGCAGGGCAGG + Intronic
980859019 4:138476840-138476862 TAAAGTGAACAGGGCAGGGCAGG - Intergenic
980999493 4:139814837-139814859 CCCAGTAAAGAGCGTAGGGCTGG + Intronic
981034397 4:140154203-140154225 CTCAGTAAACACGGCAGCGGCGG + Intergenic
982176791 4:152713147-152713169 TACAGTAAACATGGGAGTGCAGG - Intronic
984065468 4:175042891-175042913 TACAGGAAACATGGCTGGGCAGG - Intergenic
985725892 5:1515567-1515589 CAGGGTATACAGGGCAGGCCAGG - Intronic
985854807 5:2416571-2416593 CACAGGATGCAGGGCATGGCAGG - Intergenic
986557553 5:9026548-9026570 CACAGTTCACAGGGCTGGGGAGG - Intergenic
986590658 5:9365955-9365977 AAGAGTAAGCAGTGCAGGGCTGG - Intronic
987336420 5:16901504-16901526 CATTGTTAATAGGGCAGGGCTGG - Intronic
987595220 5:19988668-19988690 CCCAGGAAATAAGGCAGGGCAGG + Intronic
987711829 5:21510818-21510840 AACAGTAAAGAGGGCAGGCATGG - Intergenic
988215304 5:28264338-28264360 CACGCTAAAGAGGGCAGAGCAGG - Intergenic
988302583 5:29449966-29449988 AACAGTAAAGAGGGCAGGCATGG + Intergenic
988958741 5:36347912-36347934 TCCAGTAAACAGGTAAGGGCTGG - Intergenic
989094588 5:37770078-37770100 CACACAATACAGGGCAGAGCTGG - Intergenic
991577435 5:68119855-68119877 CACAGTAAACAAGGCAGGTCAGG - Intergenic
991658592 5:68927791-68927813 CACAGGATAGGGGGCAGGGCAGG + Intergenic
991734587 5:69620149-69620171 CAAAATAAACGGGGCGGGGCGGG - Intergenic
991762192 5:69929957-69929979 AACAGTAAAGAGGGCAGGCATGG - Intergenic
991780391 5:70126572-70126594 CAAAATAAACGGGGCGGGGCGGG + Intergenic
991785136 5:70188143-70188165 AACAGTAAAGAGGGCAGGCATGG + Intergenic
991811021 5:70475290-70475312 CAAAATAAACGGGGCGGGGCGGG - Intergenic
991841420 5:70805006-70805028 AACAGTAAAGAGGGCAGGCATGG - Intergenic
991859678 5:71001986-71002008 CAAAATAAACGGGGCGGGGCGGG + Intronic
991872838 5:71126883-71126905 CAAAATAAACGGGGCGGGGCGGG + Intergenic
991877583 5:71188541-71188563 AACAGTAAAGAGGGCAGGCATGG + Intergenic
996556862 5:124787056-124787078 AACAGTAAACAGGCCAGGCGCGG - Intergenic
998561593 5:143177462-143177484 CACAGAAAACCTGGCAGAGCTGG + Intronic
999256447 5:150212264-150212286 CACTGTAATCAGGGCCAGGCTGG - Intronic
999260658 5:150236761-150236783 CATAATTCACAGGGCAGGGCTGG + Intronic
1000437501 5:161230970-161230992 CACAGTGATCAGGGCAGAGTGGG + Intergenic
1000747787 5:165056494-165056516 CACAGTAGACAGGCCATGGGAGG - Intergenic
1001102472 5:168825457-168825479 CACAGTAAATATGGGAGGGAGGG - Intronic
1001213407 5:169832457-169832479 CAGGGTAAACAAGGCAGGGTGGG - Intronic
1003535522 6:6972311-6972333 CATAGAAGACAGGGCAGGCCAGG + Intergenic
1004001049 6:11597624-11597646 TGCAATAAACAGGGGAGGGCAGG + Intergenic
1005003037 6:21261833-21261855 CACAGTAAGCATGGCTGGGGAGG - Intergenic
1007568564 6:42872454-42872476 GACAGTAAAAAGAGCAGGGCCGG + Intergenic
1009005875 6:57785873-57785895 AACAGTAAAGAGGGCAGGCATGG + Intergenic
1009409578 6:63350554-63350576 CAAAGTAAACAGTTCAGGCCAGG + Intergenic
1009977812 6:70691910-70691932 CACAATAAACATGGCCGTGCAGG + Intronic
1011352501 6:86437834-86437856 CACATTACAATGGGCAGGGCTGG - Intergenic
1012112885 6:95259589-95259611 CACAGGATACAGGGCATGGCAGG + Intergenic
1014736315 6:125099504-125099526 CACAGTATAGAGGGCGGGGGCGG + Intergenic
1016568951 6:145491575-145491597 CACAGGATAGGGGGCAGGGCAGG + Intergenic
1017758790 6:157552326-157552348 CAGAGTCGGCAGGGCAGGGCAGG + Intronic
1017998939 6:159561124-159561146 CACAGGAAGAAGAGCAGGGCAGG + Intergenic
1018220790 6:161576732-161576754 AACAGTATAAAGGGCAGGGTTGG + Intronic
1018826415 6:167410650-167410672 CCCAGAAAGCAAGGCAGGGCTGG + Intergenic
1019123652 6:169825036-169825058 AACAGGACCCAGGGCAGGGCAGG - Intergenic
1019209670 6:170394887-170394909 GACAGTACCCATGGCAGGGCTGG + Intronic
1019285758 7:222143-222165 GTCAGGAGACAGGGCAGGGCTGG + Intronic
1019328886 7:453023-453045 CAGAGGGAACAGGGCAGGCCAGG + Intergenic
1019415094 7:923394-923416 CACAGGAAGCAGGGAGGGGCCGG + Intronic
1019917116 7:4140636-4140658 CACAGTAAACAGGGCAGGGCTGG - Intronic
1020023416 7:4882897-4882919 GACAGGCGACAGGGCAGGGCAGG + Intronic
1021959655 7:25858983-25859005 CCCAGTAAACAGGGAGGGCCCGG + Intergenic
1022157859 7:27678390-27678412 AACAGTTAACATGGCAGGCCTGG - Intergenic
1022161880 7:27719268-27719290 CACATTAAACAGAGCAGGGAAGG + Intergenic
1023131684 7:37009711-37009733 CACTGTAAACAGAGCATGGAAGG - Intronic
1023873096 7:44273250-44273272 CACAGTGAACAGGCAGGGGCTGG - Intronic
1024318294 7:48041526-48041548 CACACTGAACAGGGCAGGAGGGG - Intronic
1024339150 7:48239475-48239497 AACAGTAAACATGGCAGGGCAGG - Intronic
1024629620 7:51236382-51236404 CACAGAGGACAGGACAGGGCAGG + Intronic
1025730348 7:64102245-64102267 CACAGCCCCCAGGGCAGGGCAGG - Intronic
1025928953 7:65980085-65980107 CACAGCCCCCAGGGCAGGGCAGG + Intronic
1029314514 7:99699375-99699397 CACAGGAAAGAGGGAAGAGCCGG + Intronic
1029320155 7:99751835-99751857 CACAGGAAAGAGGGAAGAGCCGG + Intergenic
1029493008 7:100882422-100882444 GACAGGAGACAGGGCGGGGCGGG - Intronic
1030313973 7:108095447-108095469 CACAATAAACCTGGCAGGGCAGG - Intronic
1030338171 7:108347887-108347909 CAGAGTAAATAAAGCAGGGCAGG - Intronic
1032749262 7:134820935-134820957 CACAGTAAACAGTGAAGGAGAGG + Intronic
1033630564 7:143153524-143153546 CACAGTAAAAAGGGAAAAGCAGG + Intergenic
1033857205 7:145578054-145578076 TACAGGATGCAGGGCAGGGCAGG + Intergenic
1034224441 7:149471785-149471807 CACAGCAGAGAGGTCAGGGCTGG + Intergenic
1036821455 8:11943049-11943071 CCCAGCACACAGGGGAGGGCAGG + Intergenic
1036986332 8:13535435-13535457 TACAGTAAACAAGGTAGAGCAGG - Intergenic
1040735021 8:50495392-50495414 CACAGGATACAGGACAGAGCTGG - Intronic
1040960258 8:53024406-53024428 CAGAGTAAACAAGGAAGGCCAGG - Intergenic
1042040848 8:64587066-64587088 TCCAGTAAACAGGGCTGGGTAGG + Intergenic
1042626539 8:70764222-70764244 CAGAGTAAAGAGGGCAGAGAAGG - Intronic
1043177416 8:77039911-77039933 CAGAGAAAAGAGGGCAGGGACGG - Intergenic
1044039855 8:87354122-87354144 GACAGGACACAGAGCAGGGCTGG - Intronic
1046249366 8:111610066-111610088 CACAGTACACCTTGCAGGGCTGG - Intergenic
1047139731 8:122124344-122124366 CAGAGTAAACAGCTTAGGGCTGG - Intergenic
1047744371 8:127833266-127833288 CACAATCCCCAGGGCAGGGCAGG - Intergenic
1049051104 8:140197364-140197386 GCCTGTAAAGAGGGCAGGGCAGG + Intronic
1049793389 8:144483859-144483881 AAAAGAAAACAGGGAAGGGCTGG - Intronic
1049955098 9:685908-685930 CTCAGTAAACTGGGCAGGGATGG - Intronic
1052518299 9:29511220-29511242 CACAGTAGACATGGCTGGGGAGG + Intergenic
1052875194 9:33554423-33554445 CTCAGTAAAAAGGTCAGAGCTGG + Intronic
1053108732 9:35438304-35438326 AACAGGAAGCAGGGCAGGGTAGG + Intergenic
1053199803 9:36144658-36144680 CAGAGTAATGTGGGCAGGGCAGG - Intronic
1053447830 9:38166539-38166561 CTCAGGAAACTGGGCTGGGCTGG + Intergenic
1053500827 9:38589907-38589929 CTCAGTAAAAAGGTCAGAGCTGG - Intergenic
1055430527 9:76239047-76239069 CACAGTTGTCTGGGCAGGGCAGG - Exonic
1056427092 9:86488348-86488370 CACAGGATAAGGGGCAGGGCAGG - Intergenic
1057215360 9:93224898-93224920 CACAGTCAACAAGCCAGGGCAGG - Intronic
1057517693 9:95735967-95735989 CTCAATGAACAGGGCAGGGCAGG + Intergenic
1057680234 9:97174400-97174422 CTCAGTAAAAAGGTCAGAGCTGG - Intergenic
1057804518 9:98210842-98210864 CACTGCAAACAGGGAAAGGCTGG + Exonic
1060222672 9:121772898-121772920 CCCAGTGAACCTGGCAGGGCTGG + Exonic
1060562650 9:124559387-124559409 CACATTATTCAGGGCAGTGCGGG - Intronic
1060590184 9:124811491-124811513 CCCAGTGACCAGGTCAGGGCTGG - Exonic
1060809985 9:126606257-126606279 AACAGAAAACAGGGCAGGGATGG - Intergenic
1060995558 9:127873452-127873474 CACAGGAGACACGGCAGGACGGG - Intronic
1061209567 9:129182928-129182950 CACAGACAACAGCGAAGGGCGGG - Intergenic
1061399215 9:130359341-130359363 CCCAGTCAACAAGGCAGTGCTGG + Intronic
1061521763 9:131122454-131122476 AACAAAAAACAGGGCAGGGTGGG - Exonic
1061923340 9:133794213-133794235 CACAGCAGACAGGCCAGAGCAGG + Intronic
1062670445 9:137705833-137705855 TACAGGTACCAGGGCAGGGCTGG - Intronic
1185592276 X:1285396-1285418 GACAGAAAACAGGGCCGGCCGGG + Intronic
1185796748 X:2972076-2972098 CACAGGACAGGGGGCAGGGCAGG + Intergenic
1185804478 X:3044807-3044829 CACAGGATAGGGGGCAGGGCAGG + Intronic
1187613126 X:20964054-20964076 CACAATAAACATGGGAGTGCAGG - Intergenic
1187906976 X:24075993-24076015 TAAAGGAAACAGGGCTGGGCGGG - Intronic
1193190520 X:78564635-78564657 TACAGTATACATGGGAGGGCAGG + Intergenic
1193511238 X:82402321-82402343 CTCAGTAAGAAGAGCAGGGCTGG - Intergenic
1193737760 X:85180261-85180283 GACAGTGAACAGGGGAGGGAAGG - Intergenic
1194551925 X:95311492-95311514 GACAGTAAACTGGGGAGGGAGGG - Intergenic
1195279607 X:103318293-103318315 CAAAGTACACAGGGCAGTTCTGG + Intergenic
1195614255 X:106900376-106900398 CCCAGGAAGCAGAGCAGGGCAGG - Exonic
1195933502 X:110103371-110103393 CAGAAAAAGCAGGGCAGGGCAGG + Intronic
1196058936 X:111386689-111386711 CAGAGAAAAGAGGGTAGGGCTGG - Intronic
1196090072 X:111731318-111731340 CACTGTAAACTGGGGAGGGAGGG - Intronic
1196466436 X:115976424-115976446 CACAGCAAACTGAGCAGGGAAGG + Intergenic
1196566571 X:117212394-117212416 CAAAGAAAAGAGAGCAGGGCGGG + Intergenic
1197280117 X:124525721-124525743 CAAAGCTAACAGGGCAGAGCTGG - Intronic
1197642306 X:128980478-128980500 TGCAGTAAACATGGCAGTGCAGG - Intergenic
1198963690 X:142206858-142206880 TGCAGCAATCAGGGCAGGGCGGG - Intergenic
1199979465 X:152913073-152913095 CACACTCAAATGGGCAGGGCAGG - Intergenic
1199981933 X:152925877-152925899 TAAGGGAAACAGGGCAGGGCAGG - Intronic
1200072753 X:153537179-153537201 CGCAGCAACCAGGGCTGGGCAGG - Intronic