ID: 1019917634

View in Genome Browser
Species Human (GRCh38)
Location 7:4143893-4143915
Sequence AAGCGTTGCAGGGATGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019917627_1019917634 10 Left 1019917627 7:4143860-4143882 CCTGACAGGCCTGCGGCGAGGGT 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1019917634 7:4143893-4143915 AAGCGTTGCAGGGATGCAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 142
1019917629_1019917634 1 Left 1019917629 7:4143869-4143891 CCTGCGGCGAGGGTCTGGCATGG 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1019917634 7:4143893-4143915 AAGCGTTGCAGGGATGCAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 142
1019917622_1019917634 27 Left 1019917622 7:4143843-4143865 CCTTGTCTTGTATGCTTCCTGAC 0: 1
1: 0
2: 1
3: 11
4: 219
Right 1019917634 7:4143893-4143915 AAGCGTTGCAGGGATGCAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019917634 Original CRISPR AAGCGTTGCAGGGATGCAGC AGG Intronic
903359167 1:22766138-22766160 GAGCTTTGAAGGGAGGCAGCCGG + Intronic
903668812 1:25023546-25023568 AAGTGTTGTTGGGATTCAGCAGG + Intergenic
903707178 1:25294897-25294919 GAGGGCTGCAGGGGTGCAGCGGG + Intronic
903720061 1:25398445-25398467 GAGGGCTGCAGGGGTGCAGCGGG - Intronic
905868753 1:41391165-41391187 CAGGGTGGCAGGGATGGAGCAGG + Intergenic
906243220 1:44255338-44255360 AAGGGTTTCAGAGATGGAGCAGG - Intronic
906559907 1:46748810-46748832 TGGCCTTGCAGGGATGGAGCAGG - Intergenic
907924075 1:58939854-58939876 AAGATTTGCAGGGCTGCAGGGGG - Intergenic
908089551 1:60671494-60671516 AAGCCTTGCTGGGGAGCAGCAGG + Intergenic
913531398 1:119736674-119736696 AAGTGCTGCATGGATGCAGGGGG + Intronic
914241467 1:145855945-145855967 AAGAGTCGCAGGGCTGCAGTAGG + Intronic
915475559 1:156150808-156150830 AAGGGTTGCAGGGGAGGAGCTGG + Intronic
916211069 1:162360381-162360403 AAGCGAAGCTGGGATGTAGCTGG + Intronic
921005837 1:211093091-211093113 ATGGGCTGCAGGGCTGCAGCTGG - Intronic
921080557 1:211735756-211735778 AAGCGCTGCAGAGATGCGGGGGG - Intergenic
1063865916 10:10365357-10365379 AAGGTTTGAAGGGCTGCAGCTGG + Intergenic
1064144938 10:12819838-12819860 CAGCGTGGCAGGGATGGAGTGGG + Intronic
1066106554 10:32162026-32162048 CAGCCTTGCAGGTATGGAGCGGG - Intergenic
1067553731 10:47253518-47253540 CAGGGTTGGAGGGATGAAGCAGG + Intergenic
1067684035 10:48456719-48456741 CTGCGGGGCAGGGATGCAGCCGG - Intronic
1067685110 10:48462079-48462101 AAGCATTGCTGGTATCCAGCAGG - Intronic
1068960223 10:62859998-62860020 AAGTTCTGCAGGGATCCAGCTGG - Intronic
1069774789 10:70919958-70919980 CAACGTGGCAGGGATGCAGGAGG - Intergenic
1073216861 10:101841212-101841234 CAGGCTTGCAGGGAAGCAGCTGG - Intronic
1074304637 10:112265381-112265403 TATCCTTGCAGGAATGCAGCAGG + Intergenic
1075454911 10:122578868-122578890 AAGCGTGGGAGGGTGGCAGCAGG + Intronic
1076837333 10:133027725-133027747 GGGCCTTGCAGGGAGGCAGCCGG + Intergenic
1077225764 11:1438498-1438520 CAGGGCTGCTGGGATGCAGCAGG - Intronic
1077434392 11:2531794-2531816 AGGTGTGGCAGGGAGGCAGCTGG - Intronic
1078867099 11:15307844-15307866 AAGAGCTACAGGGAAGCAGCAGG + Intergenic
1078934589 11:15940025-15940047 CAGCTGGGCAGGGATGCAGCAGG - Intergenic
1081706244 11:45183274-45183296 AAGCGTTGCAGCCACTCAGCCGG - Intronic
1085749899 11:79152649-79152671 AGGGGTTGGAGGAATGCAGCTGG - Intronic
1089103173 11:115981284-115981306 AAGCATTGGAGGGAGGCGGCAGG - Intergenic
1091458738 12:628125-628147 AAGCGGTGCAGGGATCCTGCAGG - Intronic
1092791785 12:12076647-12076669 GAGCCTGGGAGGGATGCAGCGGG - Intronic
1093911616 12:24754260-24754282 AAGTGATGAAGGGAGGCAGCTGG - Intergenic
1096504975 12:52087057-52087079 AAGGCTTGCAGTAATGCAGCAGG - Intergenic
1101234827 12:102777907-102777929 AAGTGTTGCAGGAAAGGAGCAGG - Intergenic
1109291550 13:60480997-60481019 TAGGGTGGCAGGGATTCAGCAGG + Intronic
1112713681 13:102159299-102159321 AAGCTTTGCTGGGTGGCAGCAGG - Intronic
1116216691 14:42025579-42025601 AGGGGTTGGAGGGATGCAGGGGG - Intergenic
1118562561 14:67102295-67102317 AAACTTTGAAGGGAAGCAGCAGG - Intronic
1118787682 14:69059664-69059686 AAGCATTGCAGGAAGGCAGGTGG - Intronic
1119646771 14:76354063-76354085 AAGCTCAGCAGGGAGGCAGCAGG - Intronic
1119698167 14:76730644-76730666 AAGTGTGGCATGGATGCAGCAGG + Intergenic
1121333664 14:93063614-93063636 CAGCCTTGGAGGGATGGAGCTGG + Intronic
1121931713 14:97978219-97978241 GAGAGTTGCAGGGAAGCAGCAGG + Intergenic
1124366166 15:29072861-29072883 AGGTGGTGCAGGGGTGCAGCTGG - Intronic
1124935525 15:34166455-34166477 AAGCCTTGCAGAGCTGCAGTGGG - Intronic
1125405757 15:39351326-39351348 CAGCTTTTCAGGGATGCAACAGG + Intergenic
1125741144 15:41965867-41965889 AAGCGCTGCAGGCCAGCAGCTGG - Intronic
1129903992 15:79173118-79173140 AAGAGCTGCAGGGATGCATGTGG - Intergenic
1130130248 15:81134791-81134813 AAGCGTGGCAGGGTTGGAGTGGG - Intronic
1130899907 15:88199442-88199464 AAATGTTGCATGGATGCAGCAGG + Intronic
1132672289 16:1106764-1106786 AGGCATGGCAGGGATGCAGTGGG - Intergenic
1132974719 16:2705598-2705620 AAGCGCATCAGGGATGCCGCAGG - Intronic
1139508244 16:67410325-67410347 GAGCCTTGCAAAGATGCAGCTGG - Intronic
1139613977 16:68078036-68078058 AAGGGCTGCAGGGATGAAACTGG - Intronic
1140894654 16:79314423-79314445 ATGGGTTGCAGTGAGGCAGCTGG + Intergenic
1141638639 16:85328877-85328899 AGGGGTGGCAGGGGTGCAGCTGG - Intergenic
1141990380 16:87605888-87605910 AAGCCAGGCAGGGATGCAGATGG + Intronic
1143251100 17:5523679-5523701 AGGCAATGCAGGGATGGAGCTGG - Intronic
1144647016 17:16981989-16982011 CAGGGGTGCGGGGATGCAGCAGG + Intergenic
1146163984 17:30574042-30574064 AAGCGCTGCTGGCATGAAGCAGG + Intergenic
1146460905 17:33045451-33045473 AAGTGTTCCAGGGATGCAGGTGG + Intronic
1147849584 17:43431480-43431502 ATGCCTTGCAGGGAGACAGCAGG - Intergenic
1147910364 17:43852657-43852679 AAGGGTGGCAGGGAAGAAGCAGG + Intronic
1148972202 17:51493388-51493410 AAGCATGGCAGGGCTACAGCTGG - Intergenic
1151752825 17:76050826-76050848 AAGCGCTGCAGGGAAGTAGCAGG - Intronic
1153834520 18:8951949-8951971 GGGCGGTGCAGGGGTGCAGCAGG - Intergenic
1153872734 18:9335113-9335135 AAGCGGCGCAGAGATGCTGCTGG - Intronic
1160209899 18:76868777-76868799 AGGCCTTGCAGGCATGCTGCCGG - Exonic
1162128813 19:8513146-8513168 AGGGGCTGGAGGGATGCAGCAGG - Exonic
1163311047 19:16514770-16514792 CAGGGCTGCAGGGATGCAGTGGG + Intronic
1165299627 19:34960642-34960664 AAGCCTTGCAGGGAAGCTCCAGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167226802 19:48249726-48249748 AAGCGCTGCAGAAACGCAGCAGG - Intronic
925435860 2:3837097-3837119 AAGCGTCTCAGGGGTCCAGCAGG - Intronic
932054922 2:68433674-68433696 ATGGGTTCCTGGGATGCAGCAGG + Intergenic
932539991 2:72641580-72641602 AAGCCTTGCAGAGCTGCAGTGGG - Intronic
937915130 2:127095239-127095261 AAGAGTTGCAGGGATCCTGGGGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
940660043 2:156534346-156534368 ACACGATGCAGGGATGCAGCAGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941155386 2:161971694-161971716 CAGTGCTGCCGGGATGCAGCCGG + Intronic
941395887 2:164972189-164972211 AAGCTTTGCAGAGAAGCAGGTGG + Intergenic
946766366 2:223044644-223044666 AGGCGATGCAGGAATGCAGGAGG - Intergenic
947322656 2:228939265-228939287 AGGCTTTGCAGGCATGCAGTTGG + Intronic
1170843218 20:19940655-19940677 AGTCTTTGCAGGGATGCAGTGGG - Intronic
1171970172 20:31559566-31559588 GAGAGTGGCAGGGAAGCAGCAGG - Intronic
1172986998 20:38999661-38999683 AAGCATTCCAGAGATACAGCTGG - Intronic
1175396359 20:58665742-58665764 AAGCGTGGCACGGATGCTGCAGG - Intronic
1175437687 20:58965787-58965809 AGGTGGTGCAGGGATGCAGCTGG + Intergenic
1180967978 22:19800438-19800460 AAGCCTGGCAGGGATCCTGCAGG - Intronic
1185271821 22:49933368-49933390 ATGAGTTGCAGGGCTGGAGCGGG - Intergenic
952613110 3:35235085-35235107 AAGCTATGCAGTCATGCAGCAGG + Intergenic
952809366 3:37387525-37387547 ATGCCTGGCAGGGATGCAGCTGG + Intronic
956279955 3:67545771-67545793 AAGTATTGCAGGGAAGCAGGTGG - Intronic
960997330 3:123348775-123348797 GAGCCTGGCAGGGAGGCAGCTGG - Intronic
961657904 3:128453465-128453487 AAGCGTTGAAGGGACGCTCCTGG + Intergenic
962108613 3:132418128-132418150 AAGAGTTGCCGGCATCCAGCAGG - Intronic
963282497 3:143398403-143398425 AAGCGTGGAAGGCAGGCAGCGGG + Intronic
964653082 3:159033644-159033666 ATCCTTTGCAGGGATGAAGCTGG - Intronic
968473795 4:793641-793663 CAGCGTTGCAGGGGTGCTCCTGG + Intronic
968666477 4:1825021-1825043 AAGGGGTGCAGGGCTCCAGCCGG - Intronic
968870508 4:3239655-3239677 AAGGGTTGCAGGAATGGAGGTGG + Intronic
969510834 4:7616966-7616988 GAGCTTTGCAGGGCTCCAGCAGG + Intronic
970222024 4:13821316-13821338 AGGCCATGCAGGGAAGCAGCAGG - Intergenic
971877222 4:32323009-32323031 ATACGTTGCAAGGATGCAACAGG - Intergenic
978572407 4:110152677-110152699 AAGCTCTGCAGTGATGCTGCTGG + Intronic
981747451 4:148065230-148065252 AAGAGTTCCAGGGAAGCAGTAGG + Intronic
982405552 4:155015996-155016018 CTGAGTTGCAGAGATGCAGCAGG + Intergenic
982819226 4:159925898-159925920 AAGTGTTGCAGGAATGAAGGAGG + Intergenic
985852714 5:2400404-2400426 GAGAGTAGCAGGGCTGCAGCAGG - Intergenic
986095048 5:4546339-4546361 AACCATTGCAGAGATGCAGGAGG + Intergenic
988704533 5:33711453-33711475 AGGCCTTGTAGGGCTGCAGCTGG + Intronic
1001292193 5:170471640-170471662 AAGCAAAGCAGGGAAGCAGCGGG + Intronic
1002000030 5:176192201-176192223 CAGCGTTCCAGGGAAGCACCTGG - Intergenic
1005216721 6:23537406-23537428 AAGCGTGGCTGGGATGCCTCAGG + Intergenic
1005348986 6:24915896-24915918 CAGAGTGGCGGGGATGCAGCTGG - Intronic
1005614602 6:27560534-27560556 AAGCTATGCTGAGATGCAGCTGG - Intergenic
1006259245 6:32854217-32854239 GTGCCTTGCAGGGATGCTGCGGG + Exonic
1010773551 6:79860033-79860055 AGGAGTTGCATGGAGGCAGCTGG - Intergenic
1016904841 6:149138152-149138174 GAGCACTGCAGGGAGGCAGCAGG + Intergenic
1019917634 7:4143893-4143915 AAGCGTTGCAGGGATGCAGCAGG + Intronic
1020875949 7:13693899-13693921 AAGGGATGCAGGGAGGCAGAAGG - Intergenic
1021048576 7:15954157-15954179 AAGCATGTCAGGGAAGCAGCAGG + Intergenic
1021146676 7:17097786-17097808 AAGCAATGCAGAAATGCAGCAGG - Intergenic
1024233848 7:47383241-47383263 GAGCGTAACAGGAATGCAGCTGG + Intronic
1027152548 7:75742762-75742784 TGGCGTGGCAGGGAGGCAGCTGG + Intergenic
1027554620 7:79648081-79648103 AAGTGTTGCGGGGAGGCTGCTGG + Intergenic
1027885850 7:83904038-83904060 AAGCGTATGAGGCATGCAGCAGG + Intergenic
1031085262 7:117296231-117296253 AAGCATGTCAGGAATGCAGCGGG + Intronic
1031581314 7:123478268-123478290 ATCCTTTGCAGGGATGAAGCTGG + Intronic
1031986375 7:128167015-128167037 AAGCCCTGCAGGGGTCCAGCCGG - Intergenic
1032471526 7:132182497-132182519 AGGGGTTGCAGAGAAGCAGCTGG - Intronic
1034013493 7:147556555-147556577 GAGAGTTGCAGTGATGCAGCAGG + Intronic
1034206282 7:149318658-149318680 TCCCGTTGCAGGGCTGCAGCAGG - Intergenic
1034881231 7:154764114-154764136 AAGCATTGCTGGGATACAGAGGG + Intronic
1036648477 8:10626456-10626478 AAGAGCTGCAGGCATGCAGCAGG + Intronic
1039480126 8:37866915-37866937 ATGTGTTGCAGGCAGGCAGCGGG + Intronic
1045971654 8:108085113-108085135 AAGCTTTGCAAGGAGGCAGGGGG - Intergenic
1048507104 8:135031574-135031596 TAGCATTGAAGGGAAGCAGCAGG + Intergenic
1059978029 9:119738682-119738704 AAGCGTTGGAGGAATTCAGGTGG + Intergenic
1060870899 9:127039378-127039400 CAGTTTTGCAGGGATGTAGCAGG + Intronic
1062443320 9:136583218-136583240 AGGCTCTCCAGGGATGCAGCAGG - Intergenic
1187774773 X:22744078-22744100 AAGGGCTGCAGGGAAGCAGAAGG - Intergenic
1191001354 X:55663006-55663028 CAGCGGTGCAGGGATCCAGTGGG - Intergenic
1192348675 X:70335894-70335916 CAGAGTTGCAGGGATGGAGAGGG - Intronic
1193477259 X:81981966-81981988 AAGCCTTGCTGAGATGCAGTGGG - Intergenic
1198261564 X:134969458-134969480 AAGCTTTGCAGGTGGGCAGCGGG + Intergenic