ID: 1019919574

View in Genome Browser
Species Human (GRCh38)
Location 7:4154914-4154936
Sequence CTGTGGCAGAGCATGGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 248}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019919574_1019919584 3 Left 1019919574 7:4154914-4154936 CCAAAATCCATGCTCTGCCACAG 0: 1
1: 0
2: 2
3: 27
4: 248
Right 1019919584 7:4154940-4154962 GGAGCATGGCAGGAGCAACGGGG No data
1019919574_1019919587 8 Left 1019919574 7:4154914-4154936 CCAAAATCCATGCTCTGCCACAG 0: 1
1: 0
2: 2
3: 27
4: 248
Right 1019919587 7:4154945-4154967 ATGGCAGGAGCAACGGGGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 205
1019919574_1019919591 18 Left 1019919574 7:4154914-4154936 CCAAAATCCATGCTCTGCCACAG 0: 1
1: 0
2: 2
3: 27
4: 248
Right 1019919591 7:4154955-4154977 CAACGGGGGTGGGGGGCTTGAGG 0: 1
1: 0
2: 6
3: 33
4: 584
1019919574_1019919589 10 Left 1019919574 7:4154914-4154936 CCAAAATCCATGCTCTGCCACAG 0: 1
1: 0
2: 2
3: 27
4: 248
Right 1019919589 7:4154947-4154969 GGCAGGAGCAACGGGGGTGGGGG 0: 1
1: 0
2: 7
3: 44
4: 737
1019919574_1019919582 1 Left 1019919574 7:4154914-4154936 CCAAAATCCATGCTCTGCCACAG 0: 1
1: 0
2: 2
3: 27
4: 248
Right 1019919582 7:4154938-4154960 AGGGAGCATGGCAGGAGCAACGG 0: 1
1: 2
2: 8
3: 81
4: 787
1019919574_1019919590 11 Left 1019919574 7:4154914-4154936 CCAAAATCCATGCTCTGCCACAG 0: 1
1: 0
2: 2
3: 27
4: 248
Right 1019919590 7:4154948-4154970 GCAGGAGCAACGGGGGTGGGGGG 0: 1
1: 0
2: 2
3: 74
4: 605
1019919574_1019919588 9 Left 1019919574 7:4154914-4154936 CCAAAATCCATGCTCTGCCACAG 0: 1
1: 0
2: 2
3: 27
4: 248
Right 1019919588 7:4154946-4154968 TGGCAGGAGCAACGGGGGTGGGG 0: 1
1: 0
2: 1
3: 41
4: 420
1019919574_1019919586 7 Left 1019919574 7:4154914-4154936 CCAAAATCCATGCTCTGCCACAG 0: 1
1: 0
2: 2
3: 27
4: 248
Right 1019919586 7:4154944-4154966 CATGGCAGGAGCAACGGGGGTGG No data
1019919574_1019919580 -7 Left 1019919574 7:4154914-4154936 CCAAAATCCATGCTCTGCCACAG 0: 1
1: 0
2: 2
3: 27
4: 248
Right 1019919580 7:4154930-4154952 GCCACAGGAGGGAGCATGGCAGG No data
1019919574_1019919583 2 Left 1019919574 7:4154914-4154936 CCAAAATCCATGCTCTGCCACAG 0: 1
1: 0
2: 2
3: 27
4: 248
Right 1019919583 7:4154939-4154961 GGGAGCATGGCAGGAGCAACGGG 0: 1
1: 0
2: 2
3: 43
4: 349
1019919574_1019919585 4 Left 1019919574 7:4154914-4154936 CCAAAATCCATGCTCTGCCACAG 0: 1
1: 0
2: 2
3: 27
4: 248
Right 1019919585 7:4154941-4154963 GAGCATGGCAGGAGCAACGGGGG 0: 1
1: 0
2: 4
3: 10
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019919574 Original CRISPR CTGTGGCAGAGCATGGATTT TGG (reversed) Intronic
901756971 1:11447244-11447266 CTGTGGCCCAGCATGGCTTCAGG + Intergenic
904301906 1:29559664-29559686 CTGCACCAGAGGATGGATTTCGG - Intergenic
904855806 1:33497444-33497466 GTGTGGAATAGCATGGATTCAGG + Intergenic
904881677 1:33702763-33702785 ATGTGCCAGAGCATATATTTTGG - Intronic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
906125711 1:43425895-43425917 CTGTGTCAGAGCAAGGAATGGGG + Exonic
909508696 1:76425813-76425835 CTGAGGTAAAGCCTGGATTTTGG - Intronic
909583267 1:77262104-77262126 ATGTGCCAGAGAATGGATTTTGG - Intergenic
911400690 1:97370982-97371004 ATGTTGCAGAGTATGGATTACGG + Intronic
916064633 1:161126220-161126242 ATGTGGCAGTGGATGGATTTAGG - Intronic
920000350 1:202793913-202793935 TTGTGGTAGAGTATGGGTTTGGG - Intronic
920382658 1:205544505-205544527 CTGTCGCAGAACATGGACTTTGG - Intergenic
923190912 1:231619821-231619843 AAGTGGCCGAGCAGGGATTTGGG - Intronic
924753888 1:246923899-246923921 CTGTGGCATAGTATGTAGTTAGG - Intronic
1064276040 10:13905933-13905955 CTGTGGCTGAACATGATTTTTGG - Intronic
1064461330 10:15537344-15537366 CTGTGGCAGTGCAGAAATTTGGG + Intronic
1065233506 10:23622653-23622675 ATGTGGCAGAGCTTGGACTAGGG - Intergenic
1065751195 10:28889369-28889391 CTGTGGAAAATCATGGGTTTCGG + Intergenic
1065754646 10:28919970-28919992 CTGGGGCAGGGGATGGTTTTGGG + Intergenic
1066039369 10:31530746-31530768 CTAGGTAAGAGCATGGATTTCGG - Intergenic
1066669439 10:37821414-37821436 CTGTTCAAGAGCATGGACTTTGG - Intronic
1066753644 10:38686802-38686824 CTGTGGCAGAGCCTTCAATTTGG - Intergenic
1067230138 10:44400305-44400327 CTTTTGTAGAGCTTGGATTTGGG - Intergenic
1067801704 10:49363519-49363541 CTGTGGCATGGCATGGAGTCAGG - Intergenic
1070523828 10:77277534-77277556 CTGTGGCAGAGCTTGGGTGCTGG - Intronic
1072621738 10:97084260-97084282 CTGGGGGAGAGCATGGCTGTGGG - Intronic
1073310698 10:102538884-102538906 GGGTGGCAGAGCTAGGATTTGGG + Intronic
1074717971 10:116237423-116237445 ATGTGGCAGAGGAAGGATTGAGG + Intronic
1075291655 10:121236255-121236277 CTGAGGCAGAGTGTGGATGTGGG - Intergenic
1075886683 10:125905655-125905677 CAGAGGCAGAACTTGGATTTGGG + Intronic
1076870290 10:133189575-133189597 CTGTGGCAGAGCTTGGGTCAGGG - Intronic
1076924499 10:133475646-133475668 CTGTGATGGAGGATGGATTTCGG + Intergenic
1078225374 11:9387039-9387061 TTGTGGCAGAACATTGATTTGGG + Intronic
1079135629 11:17774715-17774737 CTGTGGCTGAGGAAGTATTTGGG + Intronic
1080398858 11:31915611-31915633 CTGTGACAGAGCAGGGGATTTGG + Intronic
1081714376 11:45238102-45238124 ATGTGGCTGTGGATGGATTTAGG - Intergenic
1081931227 11:46872849-46872871 CTTTGGCAGAGCATGTCTTCTGG - Intronic
1083600054 11:63941291-63941313 CTGTGGCAGAGCCTGGCCTCAGG + Intronic
1084154754 11:67307322-67307344 CTGTCGCAGAGCCTGGAGTCTGG + Intronic
1084669630 11:70597387-70597409 CTTTGCCACACCATGGATTTGGG + Intronic
1085257275 11:75182240-75182262 CTGTGAAAGAGCATGGGGTTTGG - Intronic
1085511444 11:77090298-77090320 CTGTGGCAGAGCAGGAACCTGGG - Intronic
1085845424 11:80059401-80059423 CTCTGGCAGAAAATGGAATTCGG + Intergenic
1087227322 11:95615638-95615660 ATGTGGCAGAGTTTGGATTCAGG - Intergenic
1088645882 11:111915983-111916005 CTGTGGCAGACCAAGGATAGAGG - Intronic
1089458810 11:118641027-118641049 CTGTGGCCTGGCATGGAGTTTGG + Intronic
1089918813 11:122187278-122187300 CTGTGCCAGACCCTGGATTAGGG + Intergenic
1090218499 11:124993651-124993673 CTCTGGCAGAGCCTGGATCTTGG - Intronic
1092769303 12:11882392-11882414 GTGTGTCATAGCATGGGTTTTGG + Intronic
1094667222 12:32532741-32532763 CTGTGGCAGAGAATCTGTTTAGG - Intronic
1094838923 12:34334887-34334909 GTGTGGCAGAGTAGGGTTTTTGG + Intergenic
1096033585 12:48443333-48443355 CTGAAGTAGAGCATGGCTTTAGG + Intergenic
1097318582 12:58200766-58200788 CTGTGTCAAAACATGCATTTTGG - Intergenic
1097777250 12:63662706-63662728 CTGTGGCAGAGTCTGGACTTTGG - Intronic
1099479957 12:83153184-83153206 ATGTGGCAAAGCATGGGATTTGG + Intergenic
1102742069 12:115216757-115216779 CTGTGCCACTGGATGGATTTAGG + Intergenic
1102853621 12:116275708-116275730 CTTTTGGAGAGCATGCATTTTGG - Intronic
1105053579 12:133077760-133077782 CTGTTGCAGAGAATGGATTGAGG - Intergenic
1107180251 13:37450086-37450108 CTGTGGCAGAGGTTGTAATTTGG + Intergenic
1108596110 13:51950994-51951016 CTGGAGCAGAGCATGGGTTTTGG + Intronic
1108712798 13:53050395-53050417 CTGTGGATGAGAATGGATTGTGG + Exonic
1109845157 13:67979032-67979054 CTGTGTCAAAACAAGGATTTTGG - Intergenic
1110107147 13:71691870-71691892 ATGTTGCAGAGCATGGTTGTTGG + Intronic
1112197509 13:97240263-97240285 CTGTGGCAGAGCCAGGATTTGGG - Intronic
1113064843 13:106362291-106362313 CGATGGCAGAGTCTGGATTTTGG + Intergenic
1113758919 13:112834012-112834034 CAGAGACAGAGCATGGCTTTGGG - Intronic
1114298056 14:21348251-21348273 CTGTGGCAGATCCTGGAGTCAGG + Exonic
1115872683 14:37822744-37822766 GTGTGGAAAAGCATGGATTTTGG + Intronic
1117533322 14:56680270-56680292 ATGTGGCAGAGGATGGGTTGTGG - Intronic
1118781698 14:69012932-69012954 CTGGGACAGGGCATGGACTTGGG - Intergenic
1121925397 14:97922779-97922801 GTGTGCCTGAGCATGCATTTAGG - Intergenic
1122309162 14:100783674-100783696 CTGTGCCAGGGCTAGGATTTCGG + Intergenic
1123171474 14:106377037-106377059 CTGGAGCAGGGCATGGCTTTGGG + Intergenic
1123195175 14:106609499-106609521 CTGGAGCAGGGCATGGCTTTGGG + Intergenic
1202871415 14_GL000225v1_random:168310-168332 CAGAGGCAGAACTTGGATTTGGG - Intergenic
1123656005 15:22518425-22518447 CGGTGGCAGAACATGGAGGTGGG - Intergenic
1124272737 15:28297948-28297970 CGGTGGCAGAACATGGAGGTGGG + Intronic
1126859384 15:52869569-52869591 GTGTGAAAGAGCATGGGTTTGGG + Intergenic
1126932906 15:53674797-53674819 CTGTGGCAGAGCTGGGGTTAAGG - Intronic
1129112667 15:73346868-73346890 CTCTGGCAGGGCCTGGCTTTCGG - Intronic
1129868444 15:78926021-78926043 CTGAGGCACAGCCTGGACTTGGG - Intronic
1131057552 15:89384578-89384600 CTGAGGCACAGCAAGGATATGGG - Intergenic
1132562174 16:600911-600933 CTGTGGCAGAGCCTGGTGTGTGG + Intronic
1132738151 16:1397539-1397561 CTGGGGCAGGGCATGGACCTGGG + Intronic
1132738209 16:1397713-1397735 CTGGGGCAGGGCATGGACCTGGG + Intronic
1132762729 16:1518799-1518821 CTGTGGCAGAGCAGGGTGTGTGG + Intronic
1133706094 16:8356073-8356095 CTGTGCCAGTGCTTGTATTTTGG - Intergenic
1135580555 16:23622532-23622554 GTGTGGCAGAGCATGCCTTGTGG - Intronic
1137487106 16:48900655-48900677 ATGTGGCAGAGGAGGGATTGAGG - Intergenic
1138176403 16:54901925-54901947 CTGAGACATAGCAAGGATTTTGG + Intergenic
1139564092 16:67762484-67762506 GTGGAGCAGAGCATGGATTCTGG - Intronic
1140287847 16:73621454-73621476 CCATAGCAGAGGATGGATTTAGG + Intergenic
1141755370 16:85987502-85987524 GTGTGGCAGTGCAAGGATGTTGG + Intergenic
1141755766 16:85989577-85989599 GTGTGGCAGTGCAAGGATGTTGG + Intergenic
1141977544 16:87527463-87527485 CTATGGGAGAGCCAGGATTTGGG - Intergenic
1144740968 17:17582046-17582068 CGGAGGCAGAGCCTGGATGTGGG - Intronic
1145732103 17:27198615-27198637 CTGAGGCTGAGGATGGATATGGG - Intergenic
1146227567 17:31079954-31079976 CTGTGGCTGAGGATGGGTATGGG + Intergenic
1147663694 17:42131546-42131568 CTGTGGCAGAGCTATGACTTTGG - Intronic
1149034022 17:52114929-52114951 CAGTGGCAGAGCATAGCATTAGG - Intronic
1150885862 17:69084888-69084910 CAGTGGCAGAGCAGGGATGAGGG - Intronic
1153500816 18:5747861-5747883 TTGGTGCAGAGCATGGACTTTGG + Intergenic
1154489370 18:14907832-14907854 CTCTGGGAGAGCCTGGAGTTTGG - Intergenic
1156502991 18:37571377-37571399 CTCTGGCAGGGAATGGTTTTGGG + Intergenic
1156888680 18:42165203-42165225 TTGTGGGAGAGCTTGAATTTGGG - Intergenic
1157330965 18:46703567-46703589 CAGGGGAAGAGCATGGGTTTTGG - Intronic
1157420839 18:47546463-47546485 CTGTGGCAGAGCCAAGGTTTCGG - Intergenic
1157584214 18:48790937-48790959 CTGAGGGAGAGCAGGGATTGGGG - Intronic
1157688446 18:49661693-49661715 CTAGAGCAGAGCATGGAGTTTGG - Intergenic
1158153360 18:54397568-54397590 CTCTGCCAGAGCAGGGGTTTAGG - Intergenic
1158185027 18:54761858-54761880 CTCTGGGTGGGCATGGATTTTGG - Intronic
1159825669 18:73206281-73206303 CTGTGACAGATCATGGGTATGGG - Intronic
1160039366 18:75332168-75332190 GTGTGGCAGAAAATGTATTTTGG + Intergenic
1160371328 18:78374063-78374085 CTGTGTCAGAGCATTGAGCTCGG + Intergenic
1160553436 18:79710995-79711017 ATGGGGCAGAGCCTGGATTGGGG - Intronic
1162402383 19:10453998-10454020 CTGTGGCAGAGCTTGGGGGTGGG + Intronic
1163162228 19:15471599-15471621 CTGTGGCAGAGTCTGGGTCTGGG - Intronic
1163454926 19:17400886-17400908 CTGTGGCAGGGGAGGTATTTGGG + Intergenic
1164621866 19:29700885-29700907 CTGGGGCAGGGCAGGGACTTGGG - Intronic
1165846378 19:38820452-38820474 AAGTGGCAGAGCTGGGATTTTGG - Intronic
1166002107 19:39883589-39883611 CTGAGGCACAGCATGGCTTTGGG + Intronic
1166004891 19:39899840-39899862 CTGAGGCACAGCATGGCTTTGGG + Intronic
1166395864 19:42440725-42440747 GTGTGGCAGAGCCAGGATCTAGG + Intronic
1167419579 19:49395083-49395105 CTGTGACAGAGCATGCAGTGAGG - Intronic
1168527759 19:57102413-57102435 GTGAGGCAGAGCCAGGATTTAGG + Intergenic
925328155 2:3038754-3038776 CTGTGGCATAGCATGGGGTGAGG + Intergenic
926599174 2:14823217-14823239 CACTTACAGAGCATGGATTTAGG - Intergenic
927040986 2:19230123-19230145 GTGTTTCAGGGCATGGATTTGGG + Intergenic
927888948 2:26736355-26736377 CTGTGGGAGAGTGTTGATTTGGG - Intergenic
928394796 2:30935249-30935271 CAGGGGAAGAGCATGAATTTCGG - Intronic
928600208 2:32897069-32897091 CGCTGGCATAGTATGGATTTAGG - Intergenic
932624439 2:73285975-73285997 CTGTGGTTGAGCATAGACTTTGG - Intergenic
932727251 2:74189988-74190010 TTGTGGATGAACATGGATTTTGG + Intergenic
933354658 2:81196665-81196687 CAGTGGTAGAGCATCGACTTTGG + Intergenic
934185376 2:89668297-89668319 CTGTGGCAGAGCCTTCAATTTGG + Intergenic
934317027 2:91932110-91932132 CTGTGGCAGAGCCTTCAATTTGG - Intergenic
934951209 2:98576818-98576840 CTCTGGCAGGGCATGGAGTTGGG + Intronic
935023807 2:99257039-99257061 CAGTGGAAGAGCATGGATTTTGG - Intronic
936285080 2:111175550-111175572 TTGTGGCTGTGCCTGGATTTTGG + Intergenic
936669932 2:114645366-114645388 AGGTGGTAGGGCATGGATTTTGG + Intronic
937236076 2:120432595-120432617 CTGTGCCAGAGCACACATTTGGG - Intergenic
938766494 2:134463437-134463459 CTGGGGCAGACCTGGGATTTGGG - Intronic
939728983 2:145757965-145757987 CTGTGCAAGAGGATGGAGTTTGG + Intergenic
940863688 2:158795651-158795673 CTACGGCAGTGTATGGATTTGGG + Intronic
945317614 2:208387885-208387907 CAGTGGCAGAACCTAGATTTGGG + Intronic
946355628 2:219182571-219182593 CTGTACCAGAGAATGGATGTCGG - Exonic
947101069 2:226621792-226621814 CTCTAGCAGAGAGTGGATTTAGG - Intergenic
949077336 2:242069235-242069257 CTGGGGCAGAACCTGGCTTTGGG + Intergenic
1168954476 20:1825268-1825290 CGGTGGCAGGGCCTGGATTTGGG - Intergenic
1170102571 20:12718669-12718691 CTGAGCCAGAGCAAGGAGTTAGG - Intergenic
1172030130 20:31975957-31975979 ATGTGGCAGAGCCAGGGTTTTGG - Intronic
1173905628 20:46626574-46626596 CTGAGGCAGGGCAGGCATTTGGG - Intronic
1174757663 20:53175644-53175666 CTGAGGCAGAGGGTGGATTGGGG + Intronic
1175311270 20:58013066-58013088 CGCTGGCAGAAAATGGATTTGGG + Intergenic
1179994449 21:44967504-44967526 CTGTGGCAGAACAGTGAGTTGGG - Intronic
1180173111 21:46071117-46071139 CTGTGGCAGGGAAGGTATTTGGG - Intergenic
1180543385 22:16474624-16474646 CTGTGGCAGAGCCTTCAATTTGG - Intergenic
1182560235 22:31153749-31153771 CTGTGGAAGAACTGGGATTTAGG + Intergenic
1182954293 22:34406850-34406872 CTGTGTCACAGCATGCAGTTTGG + Intergenic
1184152320 22:42646297-42646319 GTGGGGCAGAGCATGGCTTGTGG - Intronic
1185061036 22:48607128-48607150 CGGAGGCAGTGCATGGATCTGGG + Intronic
950259960 3:11536460-11536482 CTGGGACAGAGCCTGGATTTTGG + Intronic
950463958 3:13142338-13142360 CTGTGTCTGAGCATGCATCTGGG - Intergenic
951924333 3:27890682-27890704 CTGTAGCAAAGCTTGGAGTTGGG + Intergenic
953670405 3:44957552-44957574 CTTAGGAAGAGAATGGATTTAGG - Intronic
953787410 3:45921497-45921519 CTTTGGCAGAGCATCCCTTTGGG + Exonic
954827141 3:53383997-53384019 CAGTGGCAGAGCAGGGAGTGGGG - Intergenic
955491069 3:59483316-59483338 CTGTGGCTGAGGTTGCATTTTGG - Intergenic
955868012 3:63406071-63406093 AGGTGGCAGAGCTGGGATTTGGG + Intronic
956034996 3:65081018-65081040 ATGTAGAAGAGCATGAATTTGGG + Intergenic
957162037 3:76622641-76622663 CTGGGGCAGAGCAGGCATTAAGG - Intronic
958001973 3:87761929-87761951 CTGTGGGACAACATGGAATTCGG - Intergenic
958781864 3:98552389-98552411 CACTGGCAGAGCATGGACTATGG - Intronic
959813978 3:110653211-110653233 CAGGGGCATAGCATGGATTATGG + Intergenic
963842419 3:150121154-150121176 CTGTGGCAAAGCTTGCATGTTGG - Intergenic
964381963 3:156106345-156106367 TAGTGAAAGAGCATGGATTTTGG + Intronic
964723658 3:159792275-159792297 GTGTGGAAGAGCATGGCTTGGGG + Intronic
966880828 3:184349801-184349823 ATGTGGCAGAGTAAGGATTTGGG + Intronic
967130714 3:186468127-186468149 CATTGGCTGAGCCTGGATTTAGG + Intergenic
967392686 3:188972660-188972682 CTGGGACAGAGCATGGATACTGG - Intronic
967498563 3:190170428-190170450 CTGAGGCAGCGTATGTATTTTGG + Intergenic
967635219 3:191792757-191792779 CTGTGGCACAGCAAGGCTGTTGG - Intergenic
968953645 4:3707368-3707390 CTGTGGCAGTGCATTGGTTTTGG + Intergenic
969063972 4:4462459-4462481 CTGTGAAAGAGCATGGGCTTTGG - Intronic
969534533 4:7747726-7747748 CTGTGGCTGTGGATGGTTTTGGG + Intergenic
970790220 4:19849495-19849517 CTGGGGCAGGGCATGTTTTTAGG - Intergenic
971045461 4:22800902-22800924 CTTAGAAAGAGCATGGATTTTGG + Intergenic
971375125 4:26050185-26050207 CTGCGGCAGAGGAGGGATCTGGG - Intergenic
976509320 4:85889965-85889987 CTTTTTCAGATCATGGATTTAGG - Intronic
977572714 4:98646213-98646235 CTGATGCAGAGCTAGGATTTTGG - Intronic
977948921 4:102947187-102947209 CTGTGGCAGAGCCTTCAATTTGG - Intronic
980892735 4:138832310-138832332 CTGTTGCAGTGAAGGGATTTGGG - Intergenic
981731804 4:147907333-147907355 ATGTGGCAGATCATGTATTGGGG + Intronic
982097139 4:151933533-151933555 AAGTGGCAGAGCATGGATTCTGG - Intergenic
982211254 4:153038626-153038648 CTGTGGCAGAGAATAGGGTTGGG - Intergenic
984486709 4:180379345-180379367 CGGTGGCAAAGCATGGAATAGGG - Intergenic
987744797 5:21956877-21956899 ATGTGGTACAGCATGGGTTTGGG + Intronic
991002008 5:61792276-61792298 CTGTGGAAGGGAATGGATTCAGG - Intergenic
991411019 5:66345904-66345926 AAGTGGCAGAGCTGGGATTTGGG - Intergenic
991765004 5:69967007-69967029 ATGTGGTACAGCATGGGTTTGGG + Intergenic
991782321 5:70151146-70151168 ATGTGGTACAGCATGGGTTTGGG - Intergenic
991844236 5:70842078-70842100 ATGTGGTACAGCATGGGTTTGGG + Intergenic
991874764 5:71151461-71151483 ATGTGGTACAGCATGGGTTTGGG - Intergenic
993395409 5:87381067-87381089 CTTTGGCAAATCATGGAATTTGG + Intronic
993395416 5:87381138-87381160 CTTTGGCAAATCATGGAATTTGG + Intronic
994674149 5:102800574-102800596 AAGTGGCAGAGCTGGGATTTAGG + Intronic
995797195 5:115954040-115954062 CTGAGGCAGAGCCTGGAATCAGG + Intergenic
996228430 5:121031164-121031186 CTGTGTGAGAGCATGTCTTTGGG - Intergenic
996929100 5:128864821-128864843 GTATGGCACAGCATGCATTTCGG + Intronic
997829552 5:137138207-137138229 GTGGGTGAGAGCATGGATTTGGG - Intronic
998856600 5:146400400-146400422 CTGGGGCAGTGCATGGCATTTGG + Intergenic
999282798 5:150375987-150376009 CTCAGGCAGAGCATGGGTTTTGG + Intronic
1000856821 5:166408731-166408753 CTTTGGGCAAGCATGGATTTTGG - Intergenic
1002763426 6:218915-218937 CGGGGACAGAGGATGGATTTTGG - Intergenic
1004206312 6:13594635-13594657 ATGTGGCTGAGCTTGTATTTGGG + Intronic
1005057278 6:21741451-21741473 CTGTGGGAGAGAAAGGCTTTTGG + Intergenic
1005659857 6:27985917-27985939 CAGTGGGAGAACATGGATTAGGG - Intergenic
1006707363 6:36032424-36032446 TTGTTGCAAAGCATTGATTTTGG + Intronic
1006719105 6:36138709-36138731 CTGTGGCAGGGACTGGATGTAGG - Exonic
1017223452 6:151992916-151992938 CTGTGCCAAAGCATGCTTTTTGG + Intronic
1019053327 6:169201307-169201329 CTGTGGCAGCACAGGGATTCTGG - Intergenic
1019919574 7:4154914-4154936 CTGTGGCAGAGCATGGATTTTGG - Intronic
1022361090 7:29658501-29658523 CTGTGGCAGAGTCTGGACTTTGG + Intergenic
1022936167 7:35180360-35180382 CTGTGGCAGAGTCTGGACTTTGG - Intergenic
1024240948 7:47435391-47435413 TTGTTGCAGATCATGGATGTGGG - Exonic
1024575836 7:50763621-50763643 CTGGGGGAGAGGAGGGATTTGGG - Intronic
1025268185 7:57485061-57485083 CTGTGGCAGTGCTTGGGTGTCGG + Intergenic
1025300999 7:57819715-57819737 CTGTGGCAGTGCTTGGGTGTCGG + Intergenic
1028348107 7:89808543-89808565 CTATGCCAGAAAATGGATTTGGG + Intergenic
1028670042 7:93391647-93391669 CTGAAGCAGAGCATTGCTTTTGG + Intergenic
1029119537 7:98257872-98257894 CTGTGGCCCAGCAGTGATTTAGG + Intronic
1029832134 7:103273072-103273094 CTGTGGCAGAGTCTGGACTTTGG - Intergenic
1030160854 7:106507155-106507177 CAGAGGCTGAGTATGGATTTTGG + Intergenic
1031941093 7:127790218-127790240 GTGAGGCAGAGCTTGGGTTTGGG + Intronic
1033413965 7:141146174-141146196 GGGTGGCAGAGCTAGGATTTGGG + Intronic
1034378394 7:150666698-150666720 ATGTGGCAGAGGATGGAGTAAGG - Intergenic
1034838958 7:154377892-154377914 CTTGGGCACTGCATGGATTTGGG + Intronic
1035535889 8:391119-391141 CTGGGGCAGAACCTGGCTTTGGG + Intergenic
1035602638 8:905769-905791 CTGTGGCAGACCATAGCTTGGGG + Intergenic
1036653084 8:10658231-10658253 ATGTGGCAGAGCCAGAATTTGGG + Intronic
1039371732 8:36991477-36991499 CTGTGGAAGAGCTGGGTTTTAGG + Intergenic
1041667304 8:60458239-60458261 CAGTGGCAGAACATAAATTTGGG + Intergenic
1042018142 8:64340179-64340201 CTGTGGGAACACATGGATTTTGG - Intergenic
1044565234 8:93655297-93655319 GTGTGTCTAAGCATGGATTTGGG + Intergenic
1044608071 8:94064314-94064336 ATGTGGCAGTGAATGGATTTGGG - Intergenic
1045641132 8:104252181-104252203 CTGTGGCATATCAGGGCTTTGGG - Intronic
1045873727 8:106954580-106954602 TTGTGGCAGAGCTTGGCTTGTGG - Intergenic
1045919566 8:107513297-107513319 CAGTGGAAAGGCATGGATTTTGG + Intergenic
1047416300 8:124667221-124667243 CTGGGGCTGTGCATGGATTCTGG + Intronic
1047918630 8:129609731-129609753 CTGGGGCAGAGCGTGGAAGTAGG - Intergenic
1048329113 8:133460333-133460355 GAGTGGCAGAGCTGGGATTTGGG - Intronic
1049418328 8:142505603-142505625 CTGTGGCAGAGGAGAGAGTTGGG + Intronic
1049615085 8:143572499-143572521 CTGAGGCAGAGCCTGGACGTGGG - Exonic
1051566286 9:18502676-18502698 ATGTGGCAAAGCATGGATAACGG - Intronic
1052422716 9:28264621-28264643 CTATGGAAAAGCATGGGTTTTGG + Intronic
1053167755 9:35856556-35856578 CTGGGGCAGAGGATGGACTTTGG + Intergenic
1053194436 9:36105192-36105214 CATTGGCAGGGCAAGGATTTGGG - Exonic
1053265932 9:36713607-36713629 CTGTGGCAGAGGATGAATTCTGG - Intergenic
1054172369 9:61854194-61854216 CTGTGGCAGTGCTTGGGTGTCGG + Exonic
1054665170 9:67726611-67726633 CTGTGGCAGTGCTTGGGTGTCGG - Intergenic
1055330260 9:75176579-75176601 GTTTGTCATAGCATGGATTTAGG - Intergenic
1056088864 9:83184965-83184987 CTGGGGCAGAGCCTGGGTCTGGG - Intergenic
1057036602 9:91816227-91816249 ATGTGGTAGAGCATGGAGGTGGG - Intronic
1058069012 9:100582761-100582783 GTGTTACAGAGCATGGATTTTGG - Intronic
1060005145 9:119993120-119993142 CTTTGGCAGAGCAGGGATGTGGG + Intergenic
1061843303 9:133372943-133372965 TGGTGGCAGAGCATGGCTGTGGG - Intronic
1203733035 Un_GL000216v2:108292-108314 CAGAGGCAGAACTTGGATTTGGG + Intergenic
1185864555 X:3611937-3611959 CTGATGCAGAACATGGATTCTGG + Intronic
1186716755 X:12260082-12260104 CTTTGGCACATCTTGGATTTAGG + Intronic
1187428122 X:19197005-19197027 CTGTGGCAGAGTAGGGATGGGGG - Intergenic
1187727818 X:22221986-22222008 TTGAGGCATAGCAAGGATTTAGG - Intronic
1192170197 X:68849685-68849707 CTGGGGAGGAGCATGGATTCTGG - Intergenic
1192488029 X:71547718-71547740 CTGTGGCAGCGCATTAGTTTTGG + Intronic
1193809282 X:86032675-86032697 CTGTGGCAGAGCAAGTTGTTTGG - Intronic
1194383357 X:93222757-93222779 CTGCAGCATAGGATGGATTTTGG - Intergenic
1195243934 X:102979383-102979405 CTGTGGCAGAGACTGGACTGAGG - Intergenic
1195810762 X:108826093-108826115 ATGTGCCTTAGCATGGATTTTGG - Intergenic
1198078185 X:133214048-133214070 CTGAGGCAGAACATGGTTTTGGG - Intergenic