ID: 1019919952

View in Genome Browser
Species Human (GRCh38)
Location 7:4157223-4157245
Sequence CCAGCTACTCCACATGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 109}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019919952_1019919960 1 Left 1019919952 7:4157223-4157245 CCCATTGCATGTGGAGTAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1019919960 7:4157247-4157269 CGGACGGACGGAAGGAAGGAAGG 0: 7
1: 25
2: 490
3: 41913
4: 37646
1019919952_1019919962 15 Left 1019919952 7:4157223-4157245 CCCATTGCATGTGGAGTAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1019919962 7:4157261-4157283 GAAGGAAGGAAGAATGAAGGAGG 0: 1
1: 13
2: 137
3: 776
4: 3664
1019919952_1019919958 -7 Left 1019919952 7:4157223-4157245 CCCATTGCATGTGGAGTAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1019919958 7:4157239-4157261 TAGCTGGACGGACGGACGGAAGG No data
1019919952_1019919964 17 Left 1019919952 7:4157223-4157245 CCCATTGCATGTGGAGTAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1019919964 7:4157263-4157285 AGGAAGGAAGAATGAAGGAGGGG No data
1019919952_1019919967 30 Left 1019919952 7:4157223-4157245 CCCATTGCATGTGGAGTAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1019919967 7:4157276-4157298 GAAGGAGGGGAAGGAAGAAAGGG No data
1019919952_1019919965 21 Left 1019919952 7:4157223-4157245 CCCATTGCATGTGGAGTAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1019919965 7:4157267-4157289 AGGAAGAATGAAGGAGGGGAAGG No data
1019919952_1019919966 29 Left 1019919952 7:4157223-4157245 CCCATTGCATGTGGAGTAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1019919966 7:4157275-4157297 TGAAGGAGGGGAAGGAAGAAAGG 0: 1
1: 1
2: 75
3: 784
4: 5833
1019919952_1019919963 16 Left 1019919952 7:4157223-4157245 CCCATTGCATGTGGAGTAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1019919963 7:4157262-4157284 AAGGAAGGAAGAATGAAGGAGGG 0: 3
1: 232
2: 1072
3: 4770
4: 16480
1019919952_1019919959 -3 Left 1019919952 7:4157223-4157245 CCCATTGCATGTGGAGTAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1019919959 7:4157243-4157265 TGGACGGACGGACGGAAGGAAGG No data
1019919952_1019919961 12 Left 1019919952 7:4157223-4157245 CCCATTGCATGTGGAGTAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1019919961 7:4157258-4157280 AAGGAAGGAAGGAAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019919952 Original CRISPR CCAGCTACTCCACATGCAAT GGG (reversed) Intronic
902851385 1:19160381-19160403 CCAGCTACTTCACTTCCAGTTGG + Intronic
903004623 1:20290598-20290620 CCAGCTCCTGCACAGGCAGTAGG + Intergenic
905812876 1:40925878-40925900 CCAGCTACTCCAGAGGCTAAGGG + Intergenic
912555953 1:110516113-110516135 CCAGCAGCTCCACAGGCTATTGG + Intergenic
920939201 1:210465155-210465177 CCACCTGCTCTACATGCATTAGG - Intronic
921832522 1:219743903-219743925 CCAGCTACTACACAGGCATTAGG + Intronic
924083354 1:240422036-240422058 CCACCTACTCCTCCTGCAGTTGG + Intronic
924161277 1:241234763-241234785 CCAGGTACTGAAGATGCAATAGG - Intronic
1065145667 10:22765262-22765284 CCATCTATTCCACATGGAAAGGG + Intergenic
1065914403 10:30341101-30341123 CCAGCTACTCCAGAGGCAGAAGG + Intronic
1067652097 10:48163812-48163834 CCAGCTCCTCCACATGCTCCCGG + Intronic
1069537177 10:69263211-69263233 CCAGCTACTTGACAGGGAATGGG - Intronic
1069908708 10:71747133-71747155 CCAGATGCTCCACATACAACTGG + Intronic
1069926654 10:71855335-71855357 CCAGCTACTCCAGAGGCTATGGG + Intergenic
1071819135 10:89262929-89262951 CCAACAACTGCACATGTAATTGG - Intronic
1072229649 10:93403542-93403564 CCAGCAATTCTACATGGAATAGG - Intronic
1078247677 11:9590625-9590647 CCAGTTACTCCAGAGGCAAGAGG - Intronic
1079656851 11:22995540-22995562 TCAGCCACTCAACAGGCAATAGG + Intergenic
1082921752 11:58503001-58503023 CCAGCTTCACCACTGGCAATTGG + Intergenic
1083731009 11:64652671-64652693 CCAGCTCCTCCATCTACAATGGG + Intronic
1084562625 11:69913134-69913156 CCATCTGCTGCCCATGCAATGGG + Intergenic
1089333920 11:117709609-117709631 CCTGCACCTCCCCATGCAATGGG - Intronic
1091830513 12:3546512-3546534 ACAGATACTCAACAGGCAATGGG + Intronic
1092078579 12:5693827-5693849 CCAGCTCCTCCACTTGCATCTGG + Intronic
1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG + Intronic
1102877573 12:116459802-116459824 CCACCTACTCCAAATGTAAATGG + Intergenic
1111735259 13:92130458-92130480 CCAGCTAATCCACATGTGGTTGG - Intronic
1111792610 13:92877867-92877889 CCACCTACGCCAAATGAAATGGG + Intergenic
1121339791 14:93098575-93098597 CCAGCTAAACCAGAAGCAATGGG + Intronic
1122181280 14:99956488-99956510 CCACCTGTTCTACATGCAATGGG - Intergenic
1124025032 15:25958246-25958268 CCAGCTACTCTTCAGTCAATGGG - Intergenic
1124853287 15:33361754-33361776 CCAGCTACTCCTCACGCACTAGG - Intronic
1125094413 15:35834487-35834509 CTAGCTGCTCCACATGCAGCTGG + Intergenic
1128863155 15:71091913-71091935 CCAACCACTCCACTTGCAATAGG - Intergenic
1131441699 15:92464425-92464447 CCAGCTACACCACAGGCAGATGG + Exonic
1133568490 16:7018257-7018279 CCAGCTTCTCCTTATGCAAGGGG + Intronic
1133687867 16:8183486-8183508 CCAGCTCCTCCTCTTGCAGTTGG + Intergenic
1134158921 16:11868555-11868577 CCATTTCCTCCACATGCATTAGG - Exonic
1139801205 16:69524452-69524474 CCAGCTACTCCACAGGGAAGGGG - Intergenic
1143609121 17:8007429-8007451 CCGGCTACTTCACATGCAAATGG + Exonic
1144498858 17:15768502-15768524 CCAGCTTCTCCACAAACAGTGGG + Intergenic
1149938723 17:60838933-60838955 CCAGCTACTCCAGAGGCAGGAGG - Intronic
1151634623 17:75337254-75337276 CCAACTGCTCCACCTGCACTGGG + Intronic
1156881701 18:42088153-42088175 CCAGCTATTCCAGTTGCAGTGGG - Intergenic
1158940250 18:62400984-62401006 CCATCTCCACCACAAGCAATGGG + Intergenic
1164697562 19:30257795-30257817 GCAGCTCCTCCAGTTGCAATGGG - Intronic
1165492417 19:36132270-36132292 CCAGCTACTCCACAGGCTGAGGG - Intergenic
1168502283 19:56903323-56903345 CCAGCTACTCCACAGGTGAAGGG - Intergenic
925659800 2:6190369-6190391 CCAGCTACTCCAGAGGCGAGAGG + Intergenic
925981661 2:9182046-9182068 CCCTCTGCTCCACATCCAATCGG - Intergenic
926512717 2:13802504-13802526 CCAGCTCCTGCAAATGCATTAGG - Intergenic
933910904 2:86940708-86940730 CCAGCTACTCCAAAGGCAGAGGG - Intronic
934021825 2:87962702-87962724 CCAGCTACTCCAAAGGCAGAGGG + Intergenic
934861984 2:97771772-97771794 CCAGTTCCTCCCCATGGAATGGG - Intronic
935990788 2:108717319-108717341 CCAGCTACTCCAAAGGCAGAGGG - Intergenic
937939552 2:127274533-127274555 CCAGCTTCCCCACAGGCAAGGGG - Intronic
939933253 2:148258169-148258191 CCAGCTACACCACATGCACTCGG + Intronic
945283074 2:208055532-208055554 CCAGGTACTCCAAGTGCATTTGG - Intergenic
947707134 2:232285388-232285410 CCAGCCTCTCCACCTGCAACTGG + Intronic
1169995992 20:11557389-11557411 ATAGCTACTGCACATGCAGTAGG + Intergenic
1170037961 20:12010024-12010046 CATGCTACTCCACCTACAATGGG + Intergenic
1173050442 20:39554523-39554545 CCAGCAATTCTACGTGCAATAGG + Intergenic
1173793690 20:45844085-45844107 CCACCTTCTCCCCATGCAAAGGG + Intronic
1174370008 20:50080133-50080155 CCATCTACTGCATATGCAGTGGG - Intergenic
1174985365 20:55445767-55445789 CCAGCCACTCTGCATGCACTGGG + Intergenic
1176122014 20:63458247-63458269 CCAGCTTCTCCACATGCTTCTGG - Intronic
1177677214 21:24316277-24316299 TCACCTTCTCCACTTGCAATAGG - Intergenic
1181987262 22:26808848-26808870 CCAGCAAGACCACAAGCAATGGG - Intergenic
1183293644 22:37017824-37017846 CCAGCTGCCCCACATGTACTAGG - Intronic
1184378028 22:44127139-44127161 GCAGCTACTCCACAAGAAAAAGG - Intronic
951079709 3:18438703-18438725 CCAGCTGCTTCACAGGCAACTGG - Intronic
954942980 3:54392147-54392169 CCTGCTTCTCCACCTGGAATTGG - Intronic
958719665 3:97828161-97828183 CCAGCTTCCCCACATGAAACTGG - Intronic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
966331827 3:178823267-178823289 CCAGCTAATCCAGAGGCATTGGG + Intronic
966853325 3:184177585-184177607 CCAGCCACTCCCCAGGGAATGGG - Intronic
972261690 4:37415357-37415379 CCAGCTTCTCCACATGAGAAGGG - Intronic
974192200 4:58520037-58520059 CCAACTTCTCCACTTGTAATAGG - Intergenic
975161640 4:71131429-71131451 CCAGCTACAGCACAGACAATGGG - Intergenic
977786620 4:101042458-101042480 CCAGCTATTCTACCTGCAAATGG + Intronic
979053691 4:115969904-115969926 CCAGCTCCTCCCCCTGCATTAGG + Intergenic
983934355 4:173490563-173490585 GCAGCAACTCCACGTGAAATGGG - Intergenic
988181254 5:27796990-27797012 CCAGCTCCTCCAGCTGCAGTTGG + Intergenic
991008845 5:61860491-61860513 TCAGCTATTTCTCATGCAATTGG - Intergenic
992949980 5:81849571-81849593 CAGGGAACTCCACATGCAATTGG - Intergenic
993144728 5:84079400-84079422 CCAGTTACTGCACACGCCATAGG - Intronic
994725256 5:103427791-103427813 CCATCTCCTACAGATGCAATAGG - Intergenic
999232284 5:150068755-150068777 GCAGCTTCTCCACATGCCTTTGG + Intronic
1001041222 5:168336880-168336902 CCACTTTCTCCACATGCAATAGG - Intronic
1002364285 5:178697972-178697994 CCAGCATCTCCAGATGCAAAGGG + Intergenic
1005766053 6:29013289-29013311 CAAGCCATTTCACATGCAATAGG - Intergenic
1014752403 6:125269936-125269958 CCAGCTTCACCAGATGCACTAGG - Intronic
1015819762 6:137248181-137248203 CCATCTTCTCCTCAAGCAATGGG - Intergenic
1016960514 6:149668548-149668570 CCAGCTACTCCAGACACAAGAGG - Intronic
1019919952 7:4157223-4157245 CCAGCTACTCCACATGCAATGGG - Intronic
1022861575 7:34372903-34372925 CCAGCTAGTTCACAGCCAATAGG - Intergenic
1023265670 7:38403425-38403447 CCAGCTCCTCCAGGTGCACTCGG + Intronic
1023898495 7:44454816-44454838 CCAACTACTCCAGAGGCTATGGG + Intronic
1024716123 7:52081485-52081507 CCAGCTACTCAACATGTTCTTGG + Intergenic
1024883543 7:54115969-54115991 CCATATGCTCCACATGCCATGGG + Intergenic
1026377607 7:69767654-69767676 CAAGCCACTGCACATACAATGGG - Intronic
1037247009 8:16846429-16846451 CCAGCTAATCCACATTCATGAGG - Intergenic
1040972085 8:53146319-53146341 CAAGCTACTTCACCTGAAATTGG + Intergenic
1041456483 8:58066403-58066425 CCAGCTCCTCCACAGACACTTGG - Intronic
1041562344 8:59233643-59233665 CCAGGTACTCAAGATGTAATTGG - Intergenic
1042028361 8:64447659-64447681 GTAGTTATTCCACATGCAATGGG - Intergenic
1043391168 8:79793807-79793829 CCAGCTTATCCACATGCTACCGG + Intergenic
1044424111 8:92031581-92031603 CCAGCTACTCCAGAGGCTAAAGG - Intronic
1060861872 9:126961311-126961333 TCAGTTTCCCCACATGCAATAGG + Intronic
1188161481 X:26809599-26809621 CCATCTACTCCACTTGGAAGAGG + Intergenic
1192986012 X:76398980-76399002 CCAGCTTCTCCACATAGTATTGG + Intergenic
1194912544 X:99664587-99664609 CCAGCTATTCCTAATCCAATTGG + Intergenic
1195124348 X:101790712-101790734 ATAGCCACTCCACATGTAATTGG + Intergenic
1196002546 X:110802275-110802297 CCAGGCACTCCACATACAGTAGG - Intergenic
1196866641 X:120076920-120076942 CCAGCTCCTGCAGCTGCAATGGG + Exonic
1196876458 X:120159361-120159383 CCAGCTCCTGCAGCTGCAATGGG - Exonic
1197675277 X:129323222-129323244 AGAGCTACTACACCTGCAATGGG - Intergenic
1201193287 Y:11467868-11467890 CCAGCTACTCCACAGGCTTAGGG - Intergenic