ID: 1019923940

View in Genome Browser
Species Human (GRCh38)
Location 7:4180176-4180198
Sequence CTGGGCATAGAGCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 3, 1: 10, 2: 5, 3: 46, 4: 358}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019923940 Original CRISPR CTGGGCATAGAGCTGGAGCT GGG (reversed) Intronic
900151948 1:1182671-1182693 CTGGGGCCAGGGCTGGAGCTTGG + Intronic
900234756 1:1582925-1582947 CTGGGCCTGGAACTGGGGCTGGG - Intergenic
900370034 1:2328207-2328229 CTGGGCATGAAGTTAGAGCTGGG + Intronic
900657051 1:3763558-3763580 CTGGTCAGTGAGCTGGAGCAGGG + Intronic
901080659 1:6581971-6581993 CTTGGGATGGAACTGGAGCTGGG + Intronic
901156780 1:7145537-7145559 CTTGGGAATGAGCTGGAGCTGGG + Intronic
901405211 1:9040519-9040541 CTGGGCATAGAGCTGGGAGTGGG - Intronic
901627001 1:10630195-10630217 CTGGGCCTGGGGCTGGGGCTGGG - Exonic
901796626 1:11683220-11683242 CAGGGCAGAGGGCTGGGGCTGGG - Intronic
901854040 1:12032651-12032673 CTCGGCTTAGAGATGGAACTGGG + Intergenic
902101550 1:13994541-13994563 CTGGGCACTGTGCTGGAGCCTGG + Intergenic
902163434 1:14550894-14550916 CTGGGGAGAGAGCTGGGGATGGG - Intergenic
902631167 1:17705533-17705555 CTGGGCCATGAGCTGGGGCTGGG + Intergenic
902631174 1:17705551-17705573 CTGGGGCTAGAGCTGGGGCTGGG + Intergenic
902973964 1:20075294-20075316 CTGGCCAAAGAGATGGAGCTGGG - Intronic
903259561 1:22124047-22124069 CTGGGCAGAGATGAGGAGCTGGG - Intronic
903361469 1:22779872-22779894 CTGGGCACAGAATTGGAGCATGG + Intronic
903385227 1:22921632-22921654 CTGGGCCTGGAGCTGGAGTTGGG + Intergenic
903603285 1:24557156-24557178 CTGGGCACCGTGCTGGTGCTGGG - Intronic
903994391 1:27296757-27296779 CTGGGGCTAGGGCTGGGGCTGGG - Intronic
903994407 1:27296793-27296815 CTGGGGCTAGGGCTGGGGCTGGG - Intronic
904819994 1:33235788-33235810 GTGGGCATAGGGGTGGACCTAGG + Intergenic
905017316 1:34786506-34786528 CTGGGGCTTGAGCTGGAGCTCGG + Intronic
905035800 1:34917825-34917847 CTGGGCCTAGTACTGGATCTGGG - Intronic
905164671 1:36072731-36072753 CTGGGCATGTGGCTGGAGCTCGG + Intergenic
905268446 1:36770973-36770995 TTGGGCATAGAGCTAGAGGGTGG - Intergenic
907454690 1:54567785-54567807 CTGGGCAGAGAGGTGGAGCCAGG - Intronic
909056445 1:70826509-70826531 CTGAGAATAGATCTGGAGGTGGG - Intergenic
910557910 1:88557132-88557154 TTTGGCATTCAGCTGGAGCTGGG + Intergenic
910707192 1:90142297-90142319 CAGAGCAAAGAGCAGGAGCTGGG + Intergenic
910864718 1:91777582-91777604 CTGGGGCTAGAGCTGGGGTTGGG - Intronic
911592053 1:99759504-99759526 CTGGGGATAGAGGTGGAAATAGG + Intronic
911775016 1:101797982-101798004 CTGGGCATAGAGATGGAGATCGG + Intergenic
915940265 1:160114396-160114418 CTGGGCACAGAGATGGAGTGAGG - Intergenic
916078849 1:161219424-161219446 CTGAGGATGGAGCTGGAGCAGGG + Intronic
917510335 1:175664198-175664220 CTGGGCAAAAACCTGGACCTAGG + Intronic
920338469 1:205260248-205260270 CTGGGCATGGATAGGGAGCTGGG + Intronic
920912518 1:210232479-210232501 CTGGGCTGCGGGCTGGAGCTGGG + Intergenic
921217544 1:212950646-212950668 CTGGGCCTGGGGCTGGGGCTGGG - Exonic
922068877 1:222170954-222170976 TTGTGCCTAGATCTGGAGCTGGG - Intergenic
922578895 1:226682453-226682475 GTGGGCAAAATGCTGGAGCTAGG - Intronic
922725461 1:227920964-227920986 CGGGGCGTACAGCTGGAGCAGGG - Exonic
922854180 1:228760149-228760171 GTGGGCAAAGAGATGGAGTTAGG + Intergenic
923567637 1:235088340-235088362 CTGGGCTTGGAGCTGGAGGCTGG + Intergenic
924557187 1:245128491-245128513 CTGGGGACAGGGCTGGAGATGGG + Intergenic
1063392784 10:5661117-5661139 CTGGGCACAGAGCTGCCACTTGG - Intronic
1066293251 10:34033065-34033087 CTGGGCTTTGAGTGGGAGCTAGG + Intergenic
1066669503 10:37821922-37821944 CTGGGCGTAGAACTGGTTCTGGG - Intronic
1067227287 10:44384515-44384537 CTGCGCACAGTGCTGGAGGTCGG - Intronic
1067432931 10:46255847-46255869 GTGGGTAGAGAGCTGGAGCCAGG - Intergenic
1067440328 10:46305590-46305612 GTGGGTAGAGAGCTGGAGCCAGG + Intronic
1067808421 10:49409013-49409035 CTGGGCACAGAGAGGCAGCTGGG - Intergenic
1067839755 10:49666243-49666265 CTGGGGCTGGAGCTGGAGCTGGG - Intergenic
1067839760 10:49666261-49666283 CTGGGGCTGGAGCTGGAGCTGGG - Intergenic
1067935300 10:50606339-50606361 ATGGGCATAGAGTTTCAGCTTGG + Intronic
1070761133 10:79025034-79025056 CTCGGCAGAGAGCTGGATCTGGG + Intergenic
1070784947 10:79157532-79157554 CTGGACATTGAGCTGGACATTGG - Intronic
1071386101 10:85122977-85122999 CTGGGCATAGAGCTAAAGCTTGG + Intergenic
1072034631 10:91552671-91552693 CTGGGGATGCAGCTGGAGCCGGG - Intergenic
1072536625 10:96369227-96369249 CTTGGCATATAGTTGGTGCTTGG - Intronic
1073286193 10:102390327-102390349 CTAGGCATTGTGCTAGAGCTGGG + Intergenic
1073364872 10:102931260-102931282 TTGGCCATAGAGCTGGAGCAGGG + Intronic
1074103780 10:110374230-110374252 CTGGGCATACAGGTGGGCCTGGG + Intergenic
1074520741 10:114220481-114220503 CTTGGCAAAGACCTGGTGCTGGG + Intronic
1075671382 10:124265999-124266021 CTGGGCACTGTGCTGGGGCTGGG - Intergenic
1075705939 10:124500886-124500908 CTGGGTATAGACCTGGAAATGGG - Intronic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1076193131 10:128496938-128496960 TTGGGCATTCAGATGGAGCTGGG - Intergenic
1076539896 10:131207200-131207222 CTGTGCCTGGAGCTGGAGATTGG - Intronic
1076565399 10:131395088-131395110 CATGGCCTAGAGATGGAGCTGGG - Intergenic
1076817288 10:132921217-132921239 CTGGGCACTGAGCTGGAGGGAGG + Intronic
1077094266 11:792681-792703 CTGGGCCGAGAGCTGGCCCTGGG + Exonic
1077265176 11:1645076-1645098 CTGGCCAGAGAGATGGAGCAGGG - Intergenic
1077915320 11:6608007-6608029 ATGGTCATTGAGCTGGAGGTGGG - Intronic
1078423796 11:11233470-11233492 CAGGTCATCGAGCTGGATCTGGG - Intergenic
1078849313 11:15149602-15149624 CTGAGCATAGAGCTGATCCTTGG + Intronic
1079028205 11:16965611-16965633 CTGGGCTTTGAGCTGGAGTAGGG - Intronic
1079608765 11:22404219-22404241 CTGTCCATAGAGCTGTAGTTAGG - Intergenic
1080485617 11:32704181-32704203 CTGGGTTTAGAGCTGTGGCTGGG - Intronic
1081695058 11:45104078-45104100 CTGGGCATAGCCCTCAAGCTAGG + Intronic
1082722904 11:56700764-56700786 CTGGGCATAAAGCAGGGGCTTGG - Exonic
1082726262 11:56740552-56740574 CTGAGCATAAAGCAGGGGCTTGG - Intergenic
1083614818 11:64021207-64021229 CATGGTAGAGAGCTGGAGCTTGG - Intronic
1084677620 11:70645352-70645374 CTGGGGATAGGGCTGGACATGGG + Intronic
1084771652 11:71346509-71346531 CTGGGCACTGTTCTGGAGCTAGG - Intergenic
1085230000 11:74958852-74958874 CTGGACATAGAGATGCAGATGGG - Intronic
1089073498 11:115718592-115718614 CTGGGCTGACAGCTGGAGCCAGG + Intergenic
1089127461 11:116186806-116186828 CTGGGCATAGGGTTGGAAGTAGG - Intergenic
1089605225 11:119637854-119637876 CAGGGTACAGAGCTGGAGGTGGG + Intronic
1090254184 11:125271768-125271790 CTGGGCTATGAGCTGGAGCAAGG - Intronic
1091300135 11:134502358-134502380 CAGGGCATAGATCTGGCTCTGGG + Intergenic
1092381055 12:7997493-7997515 CTGGGCATAGTGCTGGGGGGTGG - Intergenic
1093509505 12:19909745-19909767 TTGGGCCTAGTGCAGGAGCTCGG - Intergenic
1093994288 12:25625094-25625116 ATGGGCATAGCTCTGGAGCGAGG + Intronic
1095038623 12:37420014-37420036 CTGGGGCTGGAGCTGGCGCTGGG - Intergenic
1095330423 12:40955128-40955150 CTGGTCATAGAGTAGGAGTTGGG - Intronic
1097012849 12:55965665-55965687 CTTGGCAGTGAGCTGGAGCACGG - Intronic
1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG + Exonic
1097190154 12:57215963-57215985 GGGGGCAGAGAGCTGGGGCTGGG + Intergenic
1097330288 12:58325471-58325493 CTGTGCAGATAGCTTGAGCTAGG + Intergenic
1098157006 12:67609505-67609527 CAGGCCATGGAGCTGGAGGTAGG - Intergenic
1098162544 12:67659117-67659139 CTGTGCATGGACCTGGAGCATGG - Exonic
1099431530 12:82591955-82591977 ATGGGCATAAAGCTGTATCTAGG + Intergenic
1101021040 12:100553985-100554007 CTGGACCTTGGGCTGGAGCTGGG + Intronic
1102199656 12:111048561-111048583 CTGGACATAGAGCTGGTGCAAGG + Intronic
1102940260 12:116934964-116934986 CAGGGGTTAGAGATGGAGCTGGG - Intronic
1104065406 12:125301403-125301425 CTGGGCACAGGGCTGGTGCACGG - Intronic
1104384656 12:128339747-128339769 CTGCACATAGACCTGGAGCCAGG + Intronic
1104599134 12:130140527-130140549 CTGGCCCTAGAGCCGGAGGTTGG - Intergenic
1104943907 12:132407235-132407257 CTGGGCATCGCGCAGGAGCCAGG - Intergenic
1104989631 12:132618553-132618575 CTGGACCAAGAGCTGGGGCTGGG + Intergenic
1105239938 13:18599681-18599703 CTGAGCATAGTGCAGGCGCTGGG + Intergenic
1105281367 13:18964618-18964640 CTGGAGCTGGAGCTGGAGCTGGG - Intergenic
1106340084 13:28819731-28819753 CTGGGTCTGGGGCTGGAGCTGGG + Intergenic
1106340087 13:28819737-28819759 CTGGGGCTGGAGCTGGGGCTGGG + Intergenic
1107372314 13:39766365-39766387 CTGGGCATGGAGGTGGAGTAGGG + Intronic
1107743464 13:43479736-43479758 ATGGGCAGAAAGATGGAGCTGGG - Intronic
1107984231 13:45761152-45761174 CTAGGCATAGAGAGGAAGCTCGG + Intergenic
1109982199 13:69923857-69923879 CTGGGCCCACAGCTGCAGCTTGG - Intronic
1110411943 13:75214346-75214368 CTGGACATCAAGCTGGAACTTGG + Intergenic
1113317586 13:109199252-109199274 CAGGGCACAGAGATGGAGCGAGG - Intronic
1114615615 14:24066611-24066633 CTGCGCATGGCGCTGAAGCTTGG - Exonic
1115663608 14:35522918-35522940 ATGGCCATAGAGCTGGAGCAGGG + Intergenic
1117143952 14:52818076-52818098 CTGGGTATAGAGTTGCAGTTGGG - Intergenic
1117392923 14:55279744-55279766 CTGGGCCTACCTCTGGAGCTGGG + Intronic
1118765195 14:68904842-68904864 CTGAGGATCGAGCTGGGGCTGGG - Intronic
1119898306 14:78239159-78239181 CTCGTCATGGAGCTGGAGTTTGG - Intergenic
1119971012 14:78970724-78970746 CTGCACATAGAGCTGTAGATAGG - Intronic
1120044006 14:79786046-79786068 GTGGCCACAGTGCTGGAGCTGGG - Intronic
1121085382 14:91142176-91142198 CAGGTGGTAGAGCTGGAGCTTGG + Intronic
1121109604 14:91303446-91303468 CTGGGGAGAGAGGTGGAGCCTGG - Intronic
1122676980 14:103423646-103423668 CTTGGCCCAGAGCTGGAGCCTGG - Intronic
1122823800 14:104360005-104360027 CTTGGCTTGGAGCTGGAGATTGG - Intergenic
1122904343 14:104795164-104795186 CCGGGCCTGGAGCTGGGGCTCGG - Intronic
1123707421 15:22960102-22960124 CTGGGCACAGTGGTGGAGCCCGG - Intronic
1124030733 15:26008966-26008988 ATGGGCATAGACCAGGAGCCAGG + Intergenic
1124622194 15:31280094-31280116 CAGCACATGGAGCTGGAGCTGGG + Intergenic
1125137332 15:36358799-36358821 GTGGGCAGAGAGCTTGAGCCTGG - Intergenic
1125283032 15:38063403-38063425 CTGGGCACAGAGCCGGGGCTTGG - Intergenic
1125433549 15:39623029-39623051 CTGGGAATGGAGCTGTGGCTGGG - Intronic
1126215119 15:46145965-46145987 CTGGGTCTACAGCTGCAGCTGGG - Intergenic
1126217801 15:46176484-46176506 CTTGGCATAAAGCAGCAGCTGGG + Intergenic
1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG + Intronic
1127939317 15:63677949-63677971 CTGGTCTTAGAGTTGGAGGTCGG - Exonic
1129144026 15:73632261-73632283 CTGGGTATAGAGATGGGGGTGGG - Intronic
1129388404 15:75208208-75208230 CAGGGGATGGAGCTGGAGCAGGG - Exonic
1129752481 15:78076082-78076104 CTGGGCCCAGGCCTGGAGCTGGG - Intronic
1129766189 15:78170110-78170132 CTGGGGCTTGAGCTTGAGCTTGG + Exonic
1130417279 15:83705563-83705585 CTAGGCAGAGTGCTGGAGGTGGG + Intronic
1130921861 15:88353348-88353370 CTGGGTATAGAACTGTAGGTAGG + Intergenic
1131066870 15:89440112-89440134 CTAGGCATAGAGATGCAGCTGGG - Intergenic
1132291111 15:100704508-100704530 ATGGGCGCTGAGCTGGAGCTGGG + Intergenic
1132904341 16:2274484-2274506 ATGGGCATGGACATGGAGCTGGG + Intergenic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133234172 16:4380167-4380189 CTGGTGACAGAGCTGGAGCTGGG - Intronic
1133293075 16:4735366-4735388 CTGGGAATAGGGCAGGTGCTTGG - Intronic
1133601334 16:7342990-7343012 CTGGGACTGGAACTGGAGCTGGG + Intronic
1133653270 16:7833451-7833473 GTGGGCAAAGCGCTTGAGCTCGG + Intergenic
1133846092 16:9455066-9455088 CTGGGCATTGAGCTGGAGCCAGG - Intergenic
1134093203 16:11402484-11402506 CTGGGCTTAGAACTGGCACTCGG - Intronic
1134098618 16:11436062-11436084 CTGGGCCAGGAGCTGGAGCCAGG - Intronic
1134102477 16:11461797-11461819 CTGGCCCTGGTGCTGGAGCTGGG - Intronic
1135746614 16:25022352-25022374 CTGGCCAGAGGGCAGGAGCTGGG + Intergenic
1135755684 16:25095837-25095859 CTGGCCAGAGTGCAGGAGCTGGG + Intergenic
1136054949 16:27681487-27681509 CTGGGAATACAGCAGGAGCTTGG - Exonic
1138446332 16:57066545-57066567 CTGGACACAGAGCTGCTGCTGGG - Exonic
1139053982 16:63158604-63158626 CTGCTCATAGAACTGGAGGTTGG + Intergenic
1139311517 16:66031979-66032001 CTGTGCAGAGAGCTGTGGCTGGG - Intergenic
1139876740 16:70152044-70152066 CCGGGCATTGAGCTTGAGGTGGG + Intronic
1141156070 16:81597924-81597946 CTGGGCATAGGGTTGCACCTAGG + Intronic
1141815901 16:86409093-86409115 CTGGGCACAGGCCTGGAGCCTGG - Intergenic
1141851625 16:86650079-86650101 CTGGACATGGAGCTGGTGCCGGG + Intergenic
1142067133 16:88069029-88069051 CTGGGCCTGGGGCTGGAGCTGGG - Intronic
1142891955 17:2949439-2949461 CAGGGCATAGAGCAGGCACTCGG - Intronic
1143371755 17:6444761-6444783 CTGGGCCCAGCGCTGAAGCTCGG + Intronic
1143462673 17:7114254-7114276 CTGGAGCTGGAGCTGGAGCTGGG + Exonic
1143866073 17:9925156-9925178 CTGGTCAGAGATCTGGGGCTTGG + Intronic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1147953991 17:44122443-44122465 CTGGGATTAGATTTGGAGCTTGG - Intronic
1149169364 17:53791780-53791802 CTGGGTCTGGAGCTGCAGCTGGG - Intergenic
1149232109 17:54546250-54546272 ATGGGCATAGAGCTTTAGTTGGG + Intergenic
1149570658 17:57670011-57670033 CTGGGTCTAGGGCTGGAACTTGG + Intronic
1149659285 17:58325973-58325995 CAGGGTATAGAGCTGGAGTGGGG - Intronic
1150650740 17:67008464-67008486 CTGGGCAAAGAGCTGAGGCATGG + Intronic
1151475644 17:74343047-74343069 CTGGGCACAGACCAGGAGCCTGG + Exonic
1151718271 17:75842568-75842590 CTGGGCATTGAGCAGGGGGTAGG - Exonic
1151828196 17:76535290-76535312 CTGGCCAGAGGGCTGCAGCTGGG + Intronic
1152361719 17:79835966-79835988 CTGAGCACAGAGGTGGGGCTTGG - Intronic
1152655106 17:81515630-81515652 CAGGGCAAGGAGCTGGAGGTGGG - Intronic
1154448895 18:14459093-14459115 CTGAGCATAGTGCAGGCGCTGGG - Intergenic
1156480350 18:37432341-37432363 CTGGGCCCAGAGGGGGAGCTTGG + Intronic
1158410400 18:57200243-57200265 ATGGGCATAGAGCAGGCCCTCGG + Intergenic
1160024354 18:75206086-75206108 CTGAGCATAGAGGGGGAGATGGG + Intronic
1160331702 18:77998881-77998903 CTGGGCACTGAGCTGGTCCTGGG + Intergenic
1160572398 18:79827182-79827204 ATGGTCATGGAGCTGGGGCTCGG + Intergenic
1160807835 19:1000462-1000484 CTGGGCCTGGCGCTGGCGCTGGG + Exonic
1161450344 19:4342420-4342442 CTTGACATAGAGCAAGAGCTGGG - Intronic
1162384597 19:10353540-10353562 CTGGGCGAAGAGCAGCAGCTGGG + Exonic
1162906219 19:13825684-13825706 CTGGGCATCGCACTGGAGCTGGG + Exonic
1163145824 19:15379050-15379072 CCGGGTACAGAGCTGGAGCCCGG + Intronic
1163484123 19:17576451-17576473 AGGGGCATAGAGGTGGGGCTGGG + Intronic
1163484889 19:17579768-17579790 CAGGGCTTAGAGGTGGGGCTGGG + Intronic
1163702617 19:18793756-18793778 CTGGTCACAGTGCTGGGGCTTGG + Intergenic
1164792231 19:30997046-30997068 CTGTGCACAGTGCTTGAGCTTGG - Intergenic
1164798342 19:31054701-31054723 CTGGCCATAGAGCAAGAGCAAGG + Intergenic
1165168742 19:33875810-33875832 CTGGGCATAGAGAGGGAGTTTGG - Intergenic
1165944594 19:39434251-39434273 CTGGTAAAAGACCTGGAGCTGGG - Intronic
1166369628 19:42293684-42293706 CAGGGGCTACAGCTGGAGCTGGG - Exonic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1166740633 19:45112805-45112827 CGGGGCACAGAGCAGGTGCTGGG + Intronic
1166764842 19:45246547-45246569 CTGGGGCTGGAGCTGGTGCTGGG + Intronic
1167161260 19:47768750-47768772 GTGGGCATGGAGCTGCAGCGTGG + Intergenic
1167416906 19:49378720-49378742 TTGGGCCTAGTGCAGGAGCTCGG + Intergenic
1167523118 19:49968898-49968920 CTGGGCATAGAGGGGGGTCTGGG - Intergenic
1167676260 19:50887929-50887951 CTGGGCTAAGAGAGGGAGCTGGG + Intergenic
1168239057 19:55080298-55080320 CTGGGGGTGGAGCTGGAACTGGG + Intronic
1168255157 19:55161023-55161045 CTGGGGGTAGAGGTGGGGCTGGG - Intronic
1168277983 19:55287536-55287558 CAGGGCGAGGAGCTGGAGCTGGG - Intronic
927173359 2:20388616-20388638 CTGGGCTCAGAGCTGGACTTGGG + Intergenic
927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG + Intergenic
929102077 2:38324906-38324928 ATGGGCACAGAGCTTCAGCTGGG + Intronic
929195953 2:39184329-39184351 TTGGGCCTAGTGCAGGAGCTAGG + Intronic
929545085 2:42850527-42850549 CTGGGCCAGGGGCTGGAGCTGGG - Intergenic
932751078 2:74372138-74372160 GAGGGCATAGACCTGGAGCAAGG - Intronic
934728630 2:96641897-96641919 CTGTGCATTAAGATGGAGCTGGG - Intronic
936432444 2:112476359-112476381 ATGGGCTTACAGATGGAGCTGGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937737708 2:125312575-125312597 CTGGGTCTAGAGCTGTGGCTGGG - Intergenic
939252930 2:139706155-139706177 CTGGGCATCCAGCAGAAGCTGGG - Intergenic
939569374 2:143822389-143822411 CTTGGCAAAGAGCTAGAACTAGG - Intergenic
940630394 2:156230561-156230583 CTGGGCTCTGAGCTGGTGCTGGG - Intergenic
941998773 2:171626449-171626471 CTGGGTCTGGAGCTGTAGCTGGG - Intergenic
944245467 2:197525820-197525842 CTAGGCATAGAGCTAGATCTAGG - Intronic
945471297 2:210230347-210230369 CTGGGATTGGAGCTGGAGCTTGG + Intergenic
947528382 2:230893430-230893452 CTGGGGCTGGGGCTGGAGCTGGG - Intergenic
947626533 2:231622668-231622690 CTGGGCCTGGAGCTGGGGCTGGG - Intergenic
947926552 2:233926827-233926849 CTGGCCATAGAGCTGGAGAAGGG - Intronic
948220959 2:236269525-236269547 CTGGGCACAGAGCAGGAGCCAGG - Intergenic
948262361 2:236613605-236613627 CTGGACACAGAGCTGGAGACAGG - Intergenic
948282673 2:236760084-236760106 CTGGGGCTACAGCTGGAGCTGGG - Intergenic
948697336 2:239738251-239738273 CTGGGGATGGGGCTGGGGCTGGG - Intergenic
1168832697 20:855509-855531 CTGGACATACAGTTGGTGCTTGG - Intronic
1169014346 20:2279613-2279635 CTGGGCCTACAGCTGCAGCATGG - Intergenic
1170747584 20:19114306-19114328 CAGGGCATTGAGTTGGAGCCCGG + Intergenic
1170802269 20:19600193-19600215 CAGGGTCTGGAGCTGGAGCTGGG - Intronic
1172100158 20:32480486-32480508 TTTGGGATAGAGCTGGTGCTGGG - Intronic
1172215878 20:33235311-33235333 CCAGGCATACAGCAGGAGCTCGG + Intergenic
1172711067 20:36924019-36924041 CGGGGCAGATAGCTTGAGCTCGG + Intronic
1173530812 20:43768063-43768085 CTCAGGATAGAGCTGGAACTTGG + Intergenic
1175110745 20:56646320-56646342 CTGGGCATTGAGCTAGTGCGTGG - Intergenic
1176124403 20:63469092-63469114 CTGCGCATAGGACTGGAGCCGGG - Intronic
1176277300 20:64279657-64279679 CTGGGGATGGGGCTGGTGCTGGG + Intronic
1178635163 21:34296141-34296163 CTGGGCATACAGCAGGTGGTAGG + Intergenic
1178719929 21:34999156-34999178 CTGGACCCAGAGCCGGAGCTTGG + Intronic
1180077151 21:45468712-45468734 CGGGGCCTGGAGCTGGAGCCTGG + Exonic
1180882863 22:19218839-19218861 CTGGGCAGAGTGCTGGGGCCAGG - Intronic
1182026305 22:27121912-27121934 GTGGGCACAGTGCTGGAGGTAGG - Intergenic
1182299056 22:29328011-29328033 CTGGGCCGAGAGATGGGGCTGGG - Exonic
1182352417 22:29706322-29706344 CTGGGCATGGTGCTGGGGATGGG - Intergenic
1182834728 22:33332796-33332818 CTGGGGCTGGGGCTGGAGCTGGG - Intronic
1183096610 22:35555808-35555830 GTGGGGCTAGAGCTGGGGCTGGG - Intergenic
1184098949 22:42331499-42331521 CTGGGAATAGGGCTGGTGATGGG - Intronic
1184468933 22:44684668-44684690 CTGGGCAGAGAGCTGGGGGCGGG - Intronic
1184764412 22:46564114-46564136 CTGGGGATCTGGCTGGAGCTAGG + Intergenic
1185388696 22:50547893-50547915 CTGGGCTTAGGGCTGGGGTTGGG - Intergenic
1185388721 22:50547965-50547987 CTGGGCTTAGGGCTGGGGTTGGG - Intergenic
1185420630 22:50732424-50732446 CTGGGCAAACAGCTGGACCCAGG - Intergenic
950126898 3:10515085-10515107 CAGAGCATAGAGCAGGGGCTTGG + Intronic
950480027 3:13238352-13238374 CTGGCCCTGGGGCTGGAGCTTGG - Intergenic
950723738 3:14902389-14902411 CTGGGCAAAGACATGGAGGTTGG + Intronic
951261264 3:20512247-20512269 GTGGGCATAGGCATGGAGCTGGG + Intergenic
951527710 3:23669812-23669834 CTGGGCATGGGGCTGGAGCAGGG - Intergenic
952531332 3:34265194-34265216 CTGAGCACAGAGCTGGAATTTGG + Intergenic
954353484 3:50065147-50065169 CTGGACCTAGGGCTGGGGCTGGG + Intronic
954379840 3:50213548-50213570 GTGGGCTGAGAGCTGGCGCTGGG - Intronic
954706650 3:52484576-52484598 CTGGGCAATGGGCTGGTGCTCGG - Exonic
955291048 3:57692795-57692817 GTGGGCTTCGACCTGGAGCTGGG - Exonic
955915742 3:63906293-63906315 CTTTGCTTAGAGCTGGACCTTGG + Intronic
956825854 3:72996644-72996666 CTGGGCCTGGGGCTGGGGCTGGG + Intronic
956884640 3:73546948-73546970 TTGGGAGTAGAGCTGGACCTGGG - Intronic
958994793 3:100891919-100891941 CACAGCATAGAGCTGGGGCTGGG + Intronic
960052133 3:113249134-113249156 CTAGGCATAGAGCTGGGGTGAGG + Intronic
960941938 3:122940696-122940718 CTGGGCCTGGAGCCAGAGCTGGG - Intronic
961195828 3:125000640-125000662 CTGGGATAAGAGCTGGAGCTTGG - Intronic
961309986 3:125990484-125990506 CTGGGCCTAGAGCAGGAGAAAGG + Intergenic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
962290825 3:134134978-134135000 CTGGGCATGGAGCTGGGGGAGGG - Intronic
962369152 3:134806386-134806408 CTGGGACTTGAGCTGGAGCTGGG - Intronic
962412351 3:135152381-135152403 CTGGGGGTACAGCAGGAGCTTGG + Intronic
962734965 3:138317496-138317518 AGGGGCATAGAGCTGGACCATGG + Intronic
964010675 3:151887875-151887897 CTGGGTCTGAAGCTGGAGCTGGG + Intergenic
964011582 3:151898496-151898518 CTGGGTCTGAAGCTGGAGCTGGG - Intergenic
964168646 3:153739619-153739641 CTGGGCAGAGGGCAGGAACTTGG - Intergenic
964518487 3:157538895-157538917 CTGTGCCTAGAGGTGGAGTTTGG + Intergenic
965774096 3:172210079-172210101 CTGGGTCCAGAGCTGCAGCTGGG + Intronic
966816776 3:183896189-183896211 CTAGGCACAGAGCTGGATCCTGG - Intergenic
968075269 3:195812716-195812738 CAGGGCAGGGAGCTGGAGCCAGG + Intergenic
968615473 4:1575736-1575758 CTTGCCAGAGAGCAGGAGCTGGG + Intergenic
968759251 4:2433577-2433599 CTGGGCATGGAGAGGGGGCTCGG - Intronic
968816636 4:2824893-2824915 CTGGGCATGGGGATGGAGCTGGG - Intronic
969453190 4:7286524-7286546 CTGGGCCTGGCACTGGAGCTGGG + Intronic
969666541 4:8560612-8560634 CTGTGCATGGAGCTGGAGAGAGG + Intronic
969689547 4:8696613-8696635 CTTGGCATTGAGCAGGAGTTTGG + Intergenic
970403200 4:15737536-15737558 CCAGGCATGGAGCTGGTGCTGGG - Intronic
970406516 4:15769311-15769333 CTGGGCATGGTTCTGGTGCTAGG + Intergenic
970660620 4:18281378-18281400 TTTGTCATAGACCTGGAGCTAGG + Intergenic
972629127 4:40828439-40828461 CTGGGCACAGATCTGGAGATAGG - Intronic
973175497 4:47200088-47200110 CTGAGCATAGAATTGAAGCTGGG + Intronic
973849422 4:54946580-54946602 CTGGGCTTGGGGGTGGAGCTGGG - Intergenic
974284777 4:59850102-59850124 CTGCCCATGGATCTGGAGCTAGG + Intergenic
978119889 4:105065714-105065736 CTCTGCACAGAGCTTGAGCTGGG - Intergenic
985986534 5:3521114-3521136 CTGGGGATTTAGCTGCAGCTTGG + Intergenic
987816089 5:22902140-22902162 CTGGGTCCAGAGCTGCAGCTGGG + Intergenic
991010194 5:61874278-61874300 CTGTGCAGAGAGCTCGAGATGGG - Intergenic
996221691 5:120940567-120940589 CAGGACATAGAGCTGGAGAGAGG + Intergenic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
998166489 5:139847360-139847382 CTAGGCTTGGAGCTGGAGCTGGG - Intronic
998402595 5:141855776-141855798 CTGGGCAGGGAGCTGGGGCAAGG - Intronic
1000015716 5:157273691-157273713 CTGGGGGTAGAGTAGGAGCTTGG - Intronic
1000018758 5:157301067-157301089 CAGGGCATAGAGCTGGGCCTTGG + Intronic
1000151307 5:158503895-158503917 CAGGGGAGAGAGCTGGAGGTAGG + Intergenic
1000160929 5:158597237-158597259 CTGGGGCTGGGGCTGGAGCTAGG - Intergenic
1000240839 5:159406678-159406700 CTGGGGATAGAGTAGGAGCACGG - Intergenic
1001226643 5:169950219-169950241 AGGGGCATGGAGCTAGAGCTGGG - Intronic
1001423046 5:171601326-171601348 CTGGGCACAGAGCCAGACCTGGG - Intergenic
1001423913 5:171610868-171610890 CTTGGCATATAGTTGGTGCTCGG + Intergenic
1001774116 5:174315893-174315915 CTGGGCTTCGGGCGGGAGCTGGG + Intergenic
1001926087 5:175638301-175638323 CTGGGCATAGGGATGGCGCATGG - Intergenic
1002469964 5:179429234-179429256 CAGGGCTTAGACATGGAGCTGGG + Intergenic
1002847021 6:955820-955842 CTGGGCTGAGCACTGGAGCTGGG + Intergenic
1003442839 6:6159465-6159487 CTGGACATGGGGCTGGAGCCAGG + Intronic
1004344013 6:14831589-14831611 CTGGGCAGGGAACTGAAGCTGGG + Intergenic
1005367872 6:25097678-25097700 CTGGGTGGAGAGCTGGGGCTGGG - Intergenic
1006179509 6:32146144-32146166 CTGGGCAAATACCTGGAGGTGGG + Intergenic
1006392391 6:33766157-33766179 CAGGGCATGGTGCTGCAGCTGGG - Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006408012 6:33856368-33856390 CTGGTCAGAGAGCTGCAGGTGGG - Intergenic
1007588320 6:43006482-43006504 CTGGGCTTGGGGCTGGGGCTGGG - Exonic
1009957287 6:70471173-70471195 TTGGGCAGAGAGCTGGAGTTGGG + Intronic
1011658164 6:89570518-89570540 ATGGGTATAGAGCTTCAGCTGGG - Intronic
1012133809 6:95530371-95530393 CTTGGTATGGAGCTGGATCTGGG - Intergenic
1013627289 6:111950812-111950834 ATGGGCAGCCAGCTGGAGCTAGG - Intergenic
1013661907 6:112306630-112306652 CTGGGCACAGAGCAGGTGCTCGG + Intergenic
1015442276 6:133262988-133263010 TTGGCCATAGAATTGGAGCTAGG + Intronic
1015800150 6:137052343-137052365 CTGGGGATAGGGCTGGGGGTGGG - Intergenic
1016876595 6:148871366-148871388 CTGGGCATTGTGCTGGATCCTGG - Intronic
1018005382 6:159617312-159617334 ATGGGCAAGGAGCTGCAGCTGGG + Intergenic
1019232275 6:170577615-170577637 CTGTGCTGAGAGCTGCAGCTTGG - Exonic
1019923940 7:4180176-4180198 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923946 7:4180201-4180223 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923951 7:4180226-4180248 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923957 7:4180251-4180273 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923963 7:4180276-4180298 CAGGGCATAGAGCTAGAGCCGGG - Intronic
1019923968 7:4180301-4180323 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923973 7:4180326-4180348 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923979 7:4180351-4180373 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923985 7:4180376-4180398 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923990 7:4180401-4180423 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923994 7:4180426-4180448 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019924000 7:4180451-4180473 CAGGGCATAGAGCTGGAGCCGGG - Intronic
1019924006 7:4180476-4180498 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019924011 7:4180501-4180523 CTGGACATAGAGCTGGAGCCAGG - Intronic
1019924015 7:4180526-4180548 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1020743799 7:12055582-12055604 GTGGGCATAGAGCTGGGGTCTGG - Intergenic
1021297779 7:18930167-18930189 CTGGACATAGAGATGGAACGGGG - Intronic
1021346842 7:19539441-19539463 ATGGGCCTGGAGCTGGTGCTTGG + Intergenic
1022625615 7:32032945-32032967 GTGAGCAGAGAGCTGGAGATGGG + Intronic
1022847134 7:34221620-34221642 CTAGGCATAGAGTTGGAGGTGGG + Intergenic
1024000220 7:45184801-45184823 CTGGGCATTGAAGGGGAGCTGGG - Intronic
1024310729 7:47966599-47966621 CTGGGCATTGTACAGGAGCTTGG + Intronic
1024627471 7:51220352-51220374 CTGGCCATAGATTTGGAGCTGGG - Intronic
1025951978 7:66152562-66152584 CAGGGCAGAGAGCTGAAGGTGGG + Exonic
1026293354 7:69028765-69028787 ATAGGCATTGAGATGGAGCTGGG - Intergenic
1028633494 7:92961709-92961731 CTGAGAATGGAGCTGGAGGTGGG + Intergenic
1029459024 7:100684955-100684977 ATGGGGATGGAGCTTGAGCTGGG + Intronic
1029710677 7:102297707-102297729 CTGGGCATACAGCAGGCGCTTGG - Intronic
1033218205 7:139509427-139509449 AGGGGCCTAGAGCAGGAGCTGGG - Intergenic
1034590283 7:152132532-152132554 CTGGGCACTGAGCTGGAGCACGG + Intergenic
1034695715 7:153051527-153051549 CTGGGCAGGGAACTAGAGCTTGG - Intergenic
1034720266 7:153285651-153285673 CTGGGCATGGAACAGGGGCTGGG - Intergenic
1035520367 8:271290-271312 ACAGGCCTAGAGCTGGAGCTGGG - Intergenic
1036634727 8:10541019-10541041 GTGGGCATAGAACTCGAGCCTGG + Intronic
1038973092 8:32659710-32659732 CTGGGGAGACAGCTGGAGTTAGG - Intronic
1040577393 8:48665944-48665966 CTGTGCAGAGGTCTGGAGCTTGG + Intergenic
1043305311 8:78786816-78786838 CTGGGACTGGGGCTGGAGCTGGG - Intronic
1043935555 8:86138102-86138124 CTGGGCCGAGCACTGGAGCTGGG - Intronic
1044341497 8:91050992-91051014 CTGGACATAGATCTTGGGCTTGG + Intergenic
1045290188 8:100826263-100826285 CTGGGGCTGGAGCTGGAGCCCGG + Intergenic
1045920432 8:107522606-107522628 CTGGGCACAGGGCTGGACTTGGG - Intergenic
1046080247 8:109362517-109362539 CTGGCTCTAGTGCTGGAGCTCGG - Exonic
1047527976 8:125649977-125649999 CAGAGCAGAAAGCTGGAGCTGGG - Intergenic
1048517062 8:135120748-135120770 CTGGGCCTGGCGGTGGAGCTGGG + Intergenic
1048986744 8:139738814-139738836 CTGGGCGCAGAGCTGGTCCTGGG + Intronic
1049175642 8:141190835-141190857 CTTGGCACAGAGCTGCAGCCTGG + Intronic
1050696501 9:8285376-8285398 CTTAGAATAGAGCTGGACCTAGG - Intergenic
1051657498 9:19396993-19397015 CTGGGCATATAGCTGGAGCTAGG + Intergenic
1053148395 9:35727551-35727573 GGGGGCAGAGAGCTGGAACTGGG - Intronic
1053176633 9:35930165-35930187 CGAGGCTTAGGGCTGGAGCTTGG + Intergenic
1053271720 9:36754555-36754577 CTGGGCAATGAGATGGAGATAGG - Intergenic
1054172637 9:61855675-61855697 CTGGGGATGGGGCTGGGGCTGGG + Intergenic
1054447488 9:65384686-65384708 CTGGGGATGGGGCTGGGGCTGGG + Intergenic
1054664903 9:67725126-67725148 CTGGGGATGGGGCTGGGGCTGGG - Intergenic
1055385159 9:75753676-75753698 CTGGGTTTAGAGCTGGGGCTGGG + Intergenic
1057085643 9:92207388-92207410 CTGCTTCTAGAGCTGGAGCTGGG - Intergenic
1057307198 9:93919338-93919360 CTGGGCAGAGAGCTGGGGAGGGG - Intergenic
1057914910 9:99048011-99048033 CTGGGGATGGAGCCGGAGGTTGG + Intronic
1058773541 9:108262511-108262533 CTGGGTATAGAGTTGGACCAGGG - Intergenic
1059443585 9:114324629-114324651 CTGGGCATGCAGCAGGGGCTGGG + Intronic
1059879452 9:118673994-118674016 CTGCACAGAGACCTGGAGCTAGG + Intergenic
1060173212 9:121478489-121478511 CTTGGCATAGGGATGGTGCTGGG + Intergenic
1060194018 9:121611331-121611353 CTGGGCTTGGAGTAGGAGCTAGG + Intronic
1061252014 9:129431999-129432021 CTGGGCCTGGAGCTGGGGCTAGG + Intergenic
1061589802 9:131591005-131591027 ATGGTCATAGAGCTAGGGCTAGG + Intronic
1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG + Intronic
1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG + Exonic
1186487818 X:9946974-9946996 TTGGGAACGGAGCTGGAGCTCGG - Exonic
1186739559 X:12503196-12503218 CTGGGGATAGAGATGGGGGTTGG + Intronic
1187399444 X:18946758-18946780 GTGGGCATTGAGTTGGACCTTGG - Intronic
1187899870 X:24017550-24017572 ATGGGCATATCGCTTGAGCTCGG + Intronic
1190946609 X:55100854-55100876 CTGAGCTTAGAGATGGTGCTGGG + Intronic
1198107850 X:133477918-133477940 CTGGGAATTGAGCTGGGCCTGGG + Intergenic
1198382417 X:136096528-136096550 CTGGGACTAGAGCTGGAGAGAGG + Intergenic