ID: 1019923957

View in Genome Browser
Species Human (GRCh38)
Location 7:4180251-4180273
Sequence CTGGGCATAGAGCTGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 9, 1: 6, 2: 4, 3: 42, 4: 380}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019923957_1019923965 9 Left 1019923957 7:4180251-4180273 CCCGGCTCCAGCTCTATGCCCAG 0: 9
1: 6
2: 4
3: 42
4: 380
Right 1019923965 7:4180283-4180305 CTAGCTCTATGCCCTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019923957 Original CRISPR CTGGGCATAGAGCTGGAGCC GGG (reversed) Intronic
900373727 1:2343966-2343988 CTGGGCCTGGGGCTGGGGCCAGG + Intronic
900474578 1:2870147-2870169 GAGGGGACAGAGCTGGAGCCTGG - Intergenic
900525002 1:3124220-3124242 CTGGGCCCTGAGCTGGAGGCCGG + Intronic
900657051 1:3763558-3763580 CTGGTCAGTGAGCTGGAGCAGGG + Intronic
900767609 1:4515609-4515631 CAGGGCAGAGAGCTGGGGTCTGG - Intergenic
900777619 1:4596456-4596478 CTGAGAACAGGGCTGGAGCCCGG + Intergenic
901166453 1:7225039-7225061 CTGGGCAGGGCACTGGAGCCTGG + Intronic
901216976 1:7560408-7560430 ATGGGCTGGGAGCTGGAGCCGGG + Intronic
901405211 1:9040519-9040541 CTGGGCATAGAGCTGGGAGTGGG - Intronic
901839433 1:11944756-11944778 CAGGGCAGAGGGCTGGCGCCAGG - Intronic
902101550 1:13994541-13994563 CTGGGCACTGTGCTGGAGCCTGG + Intergenic
902114835 1:14112856-14112878 CTAGGCACAGGGCTGGAGGCTGG - Intergenic
902414720 1:16231983-16232005 CTCGACATAGGGCTGGAGGCTGG - Exonic
902631174 1:17705551-17705573 CTGGGGCTAGAGCTGGGGCTGGG + Intergenic
902973964 1:20075294-20075316 CTGGCCAAAGAGATGGAGCTGGG - Intronic
903263267 1:22142628-22142650 CTGGGCAGGGAGCCGGACCCGGG + Intronic
903361469 1:22779872-22779894 CTGGGCACAGAATTGGAGCATGG + Intronic
903385227 1:22921632-22921654 CTGGGCCTGGAGCTGGAGTTGGG + Intergenic
903465382 1:23548829-23548851 TTGGGCTAGGAGCTGGAGCCAGG + Intergenic
903479016 1:23639630-23639652 CTGAGCAAGGAGCTGGTGCCAGG - Intronic
903500337 1:23796978-23797000 CTGGGGTTAAAGCTGGTGCCTGG - Intronic
903621681 1:24702693-24702715 CTGGGAATGGGGCTGGGGCCAGG + Intergenic
903647972 1:24906086-24906108 CCAGGCATAGTGCTGCAGCCAGG - Intronic
903892405 1:26578482-26578504 GGAAGCATAGAGCTGGAGCCTGG + Intergenic
904136177 1:28314272-28314294 CTGGACAGAAAGGTGGAGCCTGG + Intergenic
904415651 1:30359731-30359753 CTGGGCACTGACTTGGAGCCAGG + Intergenic
904684126 1:32248494-32248516 CTGGAGCTGGAGCTGGAGCCCGG + Exonic
904890396 1:33775238-33775260 CTGAGCATAGGGTTGGATCCAGG - Intronic
905017316 1:34786506-34786528 CTGGGGCTTGAGCTGGAGCTCGG + Intronic
905043093 1:34976514-34976536 CTGGGCACTGAGCTGCCGCCTGG - Intergenic
905096975 1:35480953-35480975 CTGAGCCTAGAGATGGAGACAGG - Intronic
905164671 1:36072731-36072753 CTGGGCATGTGGCTGGAGCTCGG + Intergenic
905268446 1:36770973-36770995 TTGGGCATAGAGCTAGAGGGTGG - Intergenic
905927650 1:41763298-41763320 CTGGGCATAGTGCTTGCCCCAGG - Intronic
906376398 1:45300124-45300146 CTGGGCATAGACCTTGCTCCAGG + Intronic
907370744 1:54001793-54001815 CTGATCTTGGAGCTGGAGCCAGG + Intergenic
907454690 1:54567785-54567807 CTGGGCAGAGAGGTGGAGCCAGG - Intronic
907666328 1:56436525-56436547 CTGGGCACAGAGTAGGTGCCAGG - Intergenic
908351190 1:63287110-63287132 ATAGGCATAGGCCTGGAGCCTGG - Intergenic
909600491 1:77456527-77456549 CTGGGCAGAGAGCATGTGCCAGG + Intronic
910983348 1:92980318-92980340 GTGGGCAGATAGCTTGAGCCCGG - Intergenic
911176147 1:94820330-94820352 CTGGGGCTGGGGCTGGAGCCGGG - Exonic
911775016 1:101797982-101798004 CTGGGCATAGAGATGGAGATCGG + Intergenic
912734398 1:112137253-112137275 ATGGGTATTGAGCTGTAGCCAGG + Intergenic
913152626 1:116060353-116060375 GTGGACATGTAGCTGGAGCCAGG + Intronic
915321085 1:155056893-155056915 CTGGGCATTGTGGTGGAGGCAGG + Intronic
915940265 1:160114396-160114418 CTGGGCACAGAGATGGAGTGAGG - Intergenic
916078849 1:161219424-161219446 CTGAGGATGGAGCTGGAGCAGGG + Intronic
916747601 1:167696543-167696565 ATGGGAATATAGCTTGAGCCTGG - Intronic
917584999 1:176417146-176417168 CTGGAAAGAGAGCTGAAGCCAGG - Intergenic
920500033 1:206480131-206480153 CTGGGCACAGAGGGGGAGGCGGG + Intronic
921186818 1:212677660-212677682 CAGTGCAGAGAGCTGGAGACAGG + Intergenic
922212684 1:223497779-223497801 CAGTGCAAAAAGCTGGAGCCAGG + Intergenic
922725461 1:227920964-227920986 CGGGGCGTACAGCTGGAGCAGGG - Exonic
923567637 1:235088340-235088362 CTGGGCTTGGAGCTGGAGGCTGG + Intergenic
924611677 1:245578632-245578654 CTGGGCCTAATTCTGGAGCCAGG + Intronic
1065506945 10:26438745-26438767 CGGGGCAGCGACCTGGAGCCCGG + Exonic
1065593910 10:27294062-27294084 GTGAGCCTAGAGCTGGTGCCTGG - Intergenic
1067031087 10:42879191-42879213 CTGGGCATAGAGCAGGCTGCAGG + Intergenic
1067432931 10:46255847-46255869 GTGGGTAGAGAGCTGGAGCCAGG - Intergenic
1067440328 10:46305590-46305612 GTGGGTAGAGAGCTGGAGCCAGG + Intronic
1067727256 10:48779582-48779604 CTTGGGATAGACCTGAAGCCTGG + Intronic
1067832208 10:49616735-49616757 CTGGGGGTGGAGCTGTAGCCTGG - Intronic
1067839755 10:49666243-49666265 CTGGGGCTGGAGCTGGAGCTGGG - Intergenic
1067839760 10:49666261-49666283 CTGGGGCTGGAGCTGGAGCTGGG - Intergenic
1068903797 10:62299919-62299941 CTAGACATATAGATGGAGCCTGG + Intergenic
1069884506 10:71615415-71615437 GGGGGCATGGAGCTGGGGCCAGG - Intronic
1070525706 10:77294217-77294239 CTGGGCCCAGAGTTGAAGCCAGG - Intronic
1070705464 10:78634620-78634642 CCGGGCATGGGGCTGGAGGCTGG - Intergenic
1070744057 10:78922131-78922153 CTCAGCAGAGAGCTGGAGGCAGG + Intergenic
1070761133 10:79025034-79025056 CTCGGCAGAGAGCTGGATCTGGG + Intergenic
1071386101 10:85122977-85122999 CTGGGCATAGAGCTAAAGCTTGG + Intergenic
1072034631 10:91552671-91552693 CTGGGGATGCAGCTGGAGCCGGG - Intergenic
1073290330 10:102410280-102410302 CGGGCCATGGAGCTGGCGCCTGG + Intronic
1073364872 10:102931260-102931282 TTGGCCATAGAGCTGGAGCAGGG + Intronic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1076701877 10:132277484-132277506 GTGGGCACAGAACTGCAGCCGGG - Intronic
1076817288 10:132921217-132921239 CTGGGCACTGAGCTGGAGGGAGG + Intronic
1076945830 10:133649076-133649098 CTGCGCCTCGCGCTGGAGCCTGG + Intergenic
1077265176 11:1645076-1645098 CTGGCCAGAGAGATGGAGCAGGG - Intergenic
1077875189 11:6298805-6298827 CTGTTCACAGAGCTGCAGCCTGG - Intergenic
1077907870 11:6547717-6547739 TGGGGTATATAGCTGGAGCCTGG + Intronic
1079006254 11:16793422-16793444 CAGGGCCCAGAGCTGGACCCAGG - Intronic
1079028205 11:16965611-16965633 CTGGGCTTTGAGCTGGAGTAGGG - Intronic
1080880525 11:36315975-36315997 CTGTTCATGGAGATGGAGCCTGG + Intronic
1081701032 11:45152981-45153003 TTGGGCATAAGGCTGGAGGCAGG + Intronic
1082722904 11:56700764-56700786 CTGGGCATAAAGCAGGGGCTTGG - Exonic
1083899855 11:65638320-65638342 CTCGGGACTGAGCTGGAGCCCGG - Intronic
1084705854 11:70815659-70815681 CTGGGCTCAGAGCTGTAGGCAGG - Intronic
1089073498 11:115718592-115718614 CTGGGCTGACAGCTGGAGCCAGG + Intergenic
1090254184 11:125271768-125271790 CTGGGCTATGAGCTGGAGCAAGG - Intronic
1091562960 12:1628833-1628855 GTGGCCATAGAACTGAAGCCAGG - Intronic
1092381055 12:7997493-7997515 CTGGGCATAGTGCTGGGGGGTGG - Intergenic
1093994288 12:25625094-25625116 ATGGGCATAGCTCTGGAGCGAGG + Intronic
1094284303 12:28775383-28775405 CTAGGCATTGTGCTGGACCCTGG - Intergenic
1095496878 12:42794436-42794458 CTGGACATAGAGCAGGAAACAGG - Intergenic
1096231288 12:49898240-49898262 CTGGGGATTGGGGTGGAGCCGGG - Intronic
1096622662 12:52874262-52874284 CGGGGCAGAGCGCTAGAGCCGGG + Intergenic
1097012849 12:55965665-55965687 CTTGGCAGTGAGCTGGAGCACGG - Intronic
1098162544 12:67659117-67659139 CTGTGCATGGACCTGGAGCATGG - Exonic
1098455827 12:70672211-70672233 CTGGCCATGTGGCTGGAGCCAGG - Intronic
1100408784 12:94294327-94294349 CTGGGCACTGTGCTGGAGGCTGG - Intronic
1101011420 12:100454226-100454248 CAGGGCCCATAGCTGGAGCCTGG - Intergenic
1101836833 12:108301834-108301856 CAGGGCAGAGAGGTGGAGGCTGG - Intronic
1102146542 12:110658921-110658943 CTGGGCTTAGGGCTGGGGACTGG - Intronic
1102199656 12:111048561-111048583 CTGGACATAGAGCTGGTGCAAGG + Intronic
1102219264 12:111183348-111183370 ATGGGCATAGAGCTGTGCCCAGG + Intronic
1103598984 12:122042132-122042154 CTGGGGGCAGAGCTGGGGCCCGG - Intronic
1104065406 12:125301403-125301425 CTGGGCACAGGGCTGGTGCACGG - Intronic
1104384656 12:128339747-128339769 CTGCACATAGACCTGGAGCCAGG + Intronic
1104613447 12:130249465-130249487 CGGGGCATAGCTCTGGAGGCAGG + Intergenic
1104943907 12:132407235-132407257 CTGGGCATCGCGCAGGAGCCAGG - Intergenic
1106356006 13:28984016-28984038 CTGAACATAGAGCTGGAAACAGG - Intronic
1106788297 13:33129358-33129380 CTGGGCAGAGAGCAGGTCCCTGG - Exonic
1107372314 13:39766365-39766387 CTGGGCATGGAGGTGGAGTAGGG + Intronic
1107883578 13:44855269-44855291 CTGGGCCTTGTCCTGGAGCCTGG - Intergenic
1108963006 13:56260584-56260606 CTGCGCATAGCACTGGAGACTGG + Intergenic
1109133616 13:58619871-58619893 CTGGGGAAAGAGCTAAAGCCTGG + Intergenic
1113317586 13:109199252-109199274 CAGGGCACAGAGATGGAGCGAGG - Intronic
1115557488 14:34554942-34554964 CTGGGCTCAGAGCTAGAACCTGG + Intergenic
1115628709 14:35221572-35221594 CTGGTTGTAGGGCTGGAGCCAGG - Intronic
1115663608 14:35522918-35522940 ATGGCCATAGAGCTGGAGCAGGG + Intergenic
1117313459 14:54551171-54551193 CTGGGCCTGGAGCTGGGTCCTGG - Intergenic
1118307580 14:64668060-64668082 ATGGGTGTAGAGCTGGTGCCAGG + Intergenic
1121109604 14:91303446-91303468 CTGGGGAGAGAGGTGGAGCCTGG - Intronic
1121109614 14:91303483-91303505 CTGGGGAGAGGGGTGGAGCCTGG - Intronic
1122130635 14:99603110-99603132 CTGGGAAAAGGGCTGCAGCCAGG + Intronic
1122400140 14:101462131-101462153 CTGGGCACAGGACAGGAGCCAGG - Intergenic
1122676980 14:103423646-103423668 CTTGGCCCAGAGCTGGAGCCTGG - Intronic
1122951457 14:105047388-105047410 CAGGGCATGGTGCTGGAGGCAGG + Intergenic
1123450910 15:20358328-20358350 GAGGGGACAGAGCTGGAGCCAGG - Intergenic
1123487597 15:20755674-20755696 CTGGGCAGGCAGCCGGAGCCCGG + Intergenic
1123544089 15:21324732-21324754 CTGGGCAGGCAGCCGGAGCCCGG + Intergenic
1123707421 15:22960102-22960124 CTGGGCACAGTGGTGGAGCCCGG - Intronic
1124030733 15:26008966-26008988 ATGGGCATAGACCAGGAGCCAGG + Intergenic
1125137332 15:36358799-36358821 GTGGGCAGAGAGCTTGAGCCTGG - Intergenic
1125283032 15:38063403-38063425 CTGGGCACAGAGCCGGGGCTTGG - Intergenic
1125512757 15:40301778-40301800 CTAGGCACAGGGGTGGAGCCAGG - Intronic
1125733365 15:41906885-41906907 CTGGGCATAGACCTGAGTCCAGG + Intronic
1125814871 15:42575646-42575668 CTGGGCTTAGGGCGGGGGCCTGG + Exonic
1129312943 15:74725165-74725187 TAGGGGATGGAGCTGGAGCCTGG + Intronic
1129388404 15:75208208-75208230 CAGGGGATGGAGCTGGAGCAGGG - Exonic
1131066870 15:89440112-89440134 CTAGGCATAGAGATGCAGCTGGG - Intergenic
1132058610 15:98671502-98671524 AGGGGCATGGAGCTGGAGACTGG + Intronic
1202952431 15_KI270727v1_random:52005-52027 CTGGGCAGGCAGCCGGAGCCCGG + Intergenic
1132602301 16:778763-778785 CTGGGCAGAGAGGAGGAGACAGG + Intronic
1132692464 16:1187704-1187726 CTGACCATAGAGGAGGAGCCAGG + Intronic
1132739483 16:1404315-1404337 CTGTGCACAGGGCTGCAGCCTGG + Intronic
1132774664 16:1586405-1586427 CTGGGCAGAAAGATGCAGCCAGG - Intronic
1132829277 16:1919513-1919535 CTGGCCACAGGGCTGGCGCCAGG + Intergenic
1133234172 16:4380167-4380189 CTGGTGACAGAGCTGGAGCTGGG - Intronic
1133846092 16:9455066-9455088 CTGGGCATTGAGCTGGAGCCAGG - Intergenic
1133847564 16:9469484-9469506 CGGTGCAGAGAGTTGGAGCCTGG + Intergenic
1134098618 16:11436062-11436084 CTGGGCCAGGAGCTGGAGCCAGG - Intronic
1134244900 16:12532748-12532770 CTGGGGACAGGGCAGGAGCCTGG + Intronic
1135247166 16:20866920-20866942 CTGGGCACTGTGATGGAGCCTGG - Intronic
1136054949 16:27681487-27681509 CTGGGAATACAGCAGGAGCTTGG - Exonic
1138172288 16:54863988-54864010 CTAGGCATGGTGCTAGAGCCTGG + Intergenic
1138386632 16:56639769-56639791 CTGGGGACAGAGCTTGGGCCAGG + Intronic
1139253904 16:65522357-65522379 CTGGGGATAGAACTGGCCCCTGG + Intergenic
1139531303 16:67543977-67543999 CAGGGCATGGGGCTGTAGCCTGG - Intronic
1139549599 16:67666291-67666313 CGGGGCTCAGAGGTGGAGCCAGG + Intronic
1139599271 16:67976818-67976840 CTGGGGACAGGGCTGGTGCCAGG - Intronic
1140902352 16:79380994-79381016 CTGGGATTAGAGCTGCATCCTGG + Intergenic
1141647796 16:85376760-85376782 CTGGGCAGAGAGCAGGGGGCTGG + Intergenic
1141800038 16:86301250-86301272 CTGGGCTCAGAGCAGGAGACTGG - Intergenic
1141815901 16:86409093-86409115 CTGGGCACAGGCCTGGAGCCTGG - Intergenic
1141851625 16:86650079-86650101 CTGGACATGGAGCTGGTGCCGGG + Intergenic
1142067133 16:88069029-88069051 CTGGGCCTGGGGCTGGAGCTGGG - Intronic
1142156103 16:88533483-88533505 CCGGGCACCGGGCTGGAGCCCGG - Exonic
1203145622 16_KI270728v1_random:1796054-1796076 CTGGGCACAGAGCTCTAGGCAGG + Intergenic
1143108037 17:4539159-4539181 CTGGACATGGCCCTGGAGCCAGG + Intronic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1144595668 17:16568609-16568631 CAGGGCTCGGAGCTGGAGCCTGG - Intronic
1145043227 17:19592375-19592397 CTGTGCCTAGAGCCAGAGCCAGG + Intergenic
1145250989 17:21297023-21297045 GTGGGCAGAGTGCAGGAGCCAGG - Intronic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1148216794 17:45837719-45837741 CTGGGCAGGCAGATGGAGCCTGG + Intergenic
1148689715 17:49520216-49520238 CTAGACAGAGATCTGGAGCCCGG - Intergenic
1148695374 17:49555402-49555424 CTGGGCACACAGGTGGAACCAGG - Intergenic
1149659285 17:58325973-58325995 CAGGGTATAGAGCTGGAGTGGGG - Intronic
1150475308 17:65470599-65470621 ATGGGCATGGACTTGGAGCCAGG - Intergenic
1150650740 17:67008464-67008486 CTGGGCAAAGAGCTGAGGCATGG + Intronic
1151475644 17:74343047-74343069 CTGGGCACAGACCAGGAGCCTGG + Exonic
1152186139 17:78857401-78857423 CTGGTCTTAGATCAGGAGCCGGG + Intronic
1152477226 17:80526281-80526303 CTGAGCTGTGAGCTGGAGCCAGG - Intergenic
1152656747 17:81523454-81523476 CTGAGCACAGACCTGCAGCCTGG - Intronic
1153466663 18:5395679-5395701 CCAGGCACAGATCTGGAGCCAGG - Exonic
1153514461 18:5891273-5891295 CGGGGCCTGGAGCTGAAGCCCGG - Exonic
1157100421 18:44724177-44724199 CTGGGGGTTTAGCTGGAGCCAGG + Intronic
1157225887 18:45864222-45864244 CTGGGCATGGAGGCGGAGGCAGG - Intronic
1157568951 18:48699422-48699444 CTGGGGCTGGGGCTGGAGCCGGG + Intronic
1157894071 18:51447605-51447627 CTGGGCACAGCCCTGGATCCTGG + Intergenic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160536437 18:79597016-79597038 CTGGGCGAGGTGCTGGAGCCGGG - Intergenic
1160872969 19:1285560-1285582 CTGCGGATAGCGCTGGAACCGGG + Intergenic
1160929714 19:1564692-1564714 CTGGGGAGAGGGCTGGTGCCAGG + Intronic
1160959504 19:1713051-1713073 CTGGGCACAGAGCAGGGCCCTGG + Intergenic
1161612963 19:5253602-5253624 ATGGGGATGGGGCTGGAGCCAGG + Intronic
1161816587 19:6502913-6502935 CTGGGCATTGAGCTCGTCCCAGG + Intergenic
1161960549 19:7520680-7520702 CTGGGGGTGGATCTGGAGCCGGG - Exonic
1162906219 19:13825684-13825706 CTGGGCATCGCACTGGAGCTGGG + Exonic
1163145824 19:15379050-15379072 CCGGGTACAGAGCTGGAGCCCGG + Intronic
1164798342 19:31054701-31054723 CTGGCCATAGAGCAAGAGCAAGG + Intergenic
1164834391 19:31348660-31348682 CTGGGCACAGCGGTGGAACCCGG - Intronic
1165012598 19:32859684-32859706 CACGGCATGGAGCTGGAGGCAGG - Intronic
1165168742 19:33875810-33875832 CTGGGCATAGAGAGGGAGTTTGG - Intergenic
1165699852 19:37929192-37929214 CTGGGGCTGGGGCTGGAGCCGGG + Intronic
1166229960 19:41420974-41420996 CTGGGCACAGTGCTGAGGCCTGG - Intronic
1166384165 19:42370897-42370919 CTGGGAGTAGCTCTGGAGCCAGG + Intronic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1166777403 19:45321571-45321593 CCTGGCATGGAGTTGGAGCCTGG + Intronic
1167049857 19:47071795-47071817 GAGGGCATGGAGATGGAGCCCGG - Exonic
1167161260 19:47768750-47768772 GTGGGCATGGAGCTGCAGCGTGG + Intergenic
1167473541 19:49688054-49688076 ATGGGCAGGAAGCTGGAGCCCGG + Intronic
1168028061 19:53658019-53658041 CAGGGGAAAGGGCTGGAGCCAGG - Intergenic
926388798 2:12365810-12365832 CTGGTCCTAGAGGAGGAGCCAGG - Intergenic
927645357 2:24873767-24873789 AAGGGCATGGAGCTGGCGCCAGG - Intronic
929821624 2:45278621-45278643 CTGGGCTTTGGGCTGGGGCCAGG - Intergenic
929900169 2:45993791-45993813 CTGGGCACAGTGCTGTTGCCTGG + Intronic
930087146 2:47505736-47505758 CTGGGGAGAGAGATGAAGCCGGG + Intronic
930366938 2:50451195-50451217 CTGGGCAGATCGCTTGAGCCTGG - Intronic
932432885 2:71686098-71686120 CTGGGCAGTCAGCTGGAACCTGG + Intronic
932731646 2:74226079-74226101 GTGAGCATAGACCTGCAGCCAGG - Intronic
932751078 2:74372138-74372160 GAGGGCATAGACCTGGAGCAAGG - Intronic
933666995 2:84971664-84971686 CTGGGCCTGGTGCTGGAGGCGGG + Intronic
933688546 2:85161796-85161818 CTGGCCTGAGAGCAGGAGCCAGG + Intronic
934713909 2:96532256-96532278 CTAGGAATAGCGCTGGAGTCGGG - Intergenic
936010291 2:108921184-108921206 CTAGGCATAGGGTTAGAGCCTGG + Intronic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
942005001 2:171688970-171688992 CTGAGCATAAGGCAGGAGCCAGG - Intronic
942282311 2:174377729-174377751 GTGGGAAGAGAGCTTGAGCCCGG + Intronic
944245467 2:197525820-197525842 CTAGGCATAGAGCTAGATCTAGG - Intronic
945471297 2:210230347-210230369 CTGGGATTGGAGCTGGAGCTTGG + Intergenic
946142343 2:217702473-217702495 CTAGACATAGAGCTGAGGCCAGG + Intronic
946337180 2:219045740-219045762 CTGGCCTTAGAGCCAGAGCCAGG + Intergenic
946401010 2:219468476-219468498 CTGAGCAGGAAGCTGGAGCCTGG - Intronic
947626533 2:231622668-231622690 CTGGGCCTGGAGCTGGGGCTGGG - Intergenic
947926552 2:233926827-233926849 CTGGCCATAGAGCTGGAGAAGGG - Intronic
948220959 2:236269525-236269547 CTGGGCACAGAGCAGGAGCCAGG - Intergenic
948262361 2:236613605-236613627 CTGGACACAGAGCTGGAGACAGG - Intergenic
948282673 2:236760084-236760106 CTGGGGCTACAGCTGGAGCTGGG - Intergenic
948605142 2:239130221-239130243 CTGGGGATGGAGCTGAGGCCAGG + Intronic
948617755 2:239212491-239212513 CTGACCAGAGAGCTGAAGCCAGG + Intronic
948662918 2:239517823-239517845 CTGACCGTAGAGCTGGGGCCTGG - Intergenic
948882865 2:240869272-240869294 CTGGTCAATGTGCTGGAGCCTGG + Exonic
1169014346 20:2279613-2279635 CTGGGCCTACAGCTGCAGCATGG - Intergenic
1170554586 20:17505211-17505233 CTGGGCTTGGAGCTGGAAGCTGG - Intronic
1170747584 20:19114306-19114328 CAGGGCATTGAGTTGGAGCCCGG + Intergenic
1172211068 20:33198917-33198939 CTGGTCATAGCTCTGGATCCAGG - Intergenic
1173569851 20:44068984-44069006 CTGGGGCTGGAGCTGGGGCCGGG - Exonic
1173585579 20:44180563-44180585 GTGGGCAGATTGCTGGAGCCAGG - Intronic
1173594557 20:44250227-44250249 CTGGTCATAGAGCCTGGGCCTGG - Intronic
1174882674 20:54297354-54297376 CTGGGCATTGTGCTGGAAACAGG + Intergenic
1175079963 20:56411196-56411218 TTGGGGATAGAACTTGAGCCTGG + Intergenic
1175110745 20:56646320-56646342 CTGGGCATTGAGCTAGTGCGTGG - Intergenic
1175343402 20:58250385-58250407 CTGGCCATATATCTGAAGCCTGG - Intergenic
1175500373 20:59445868-59445890 CTGGGAGTAGAGTAGGAGCCAGG + Intergenic
1175852712 20:62102412-62102434 CTGGCCCAAGAGCTGAAGCCCGG + Intergenic
1175972294 20:62692775-62692797 ATGGGCATGGGGCTGGAGTCTGG - Intergenic
1176124403 20:63469092-63469114 CTGCGCATAGGACTGGAGCCGGG - Intronic
1178640080 21:34338399-34338421 CTGGGCCTCGACTTGGAGCCTGG - Intergenic
1178892058 21:36528536-36528558 GTGGGCAGAGACCTGAAGCCTGG - Intronic
1179039702 21:37791410-37791432 CTGCACATTGAGCTGGGGCCAGG + Intronic
1179622537 21:42626710-42626732 TTGCTCACAGAGCTGGAGCCTGG - Intergenic
1180077151 21:45468712-45468734 CGGGGCCTGGAGCTGGAGCCTGG + Exonic
1180161315 21:45999806-45999828 GTGGACAAAGAGCTGGTGCCAGG + Intronic
1180667669 22:17527362-17527384 ATGGGCAGATAGCTTGAGCCTGG + Intronic
1180882863 22:19218839-19218861 CTGGGCAGAGTGCTGGGGCCAGG - Intronic
1181439260 22:22927396-22927418 CTGGGCTGAGGGCTGGGGCCGGG - Intergenic
1183436242 22:37797111-37797133 TTGGGCAGAGAGCTGAAGGCAGG + Intergenic
1183439675 22:37816110-37816132 TTGGGCATAGACCTCGGGCCTGG + Intronic
1183598575 22:38826841-38826863 CTGGGCATGCAGCAGGTGCCTGG - Intronic
1184218035 22:43080281-43080303 GTGGGCAGATAGCTAGAGCCTGG - Intronic
1184468933 22:44684668-44684690 CTGGGCAGAGAGCTGGGGGCGGG - Intronic
1184967875 22:47994757-47994779 CTTGGTGTGGAGCTGGAGCCGGG + Intergenic
1185121733 22:48975372-48975394 CTTGGCACAGACGTGGAGCCTGG - Intergenic
1185420630 22:50732424-50732446 CTGGGCAAACAGCTGGACCCAGG - Intergenic
949535849 3:4995671-4995693 CCTGGCATAGAGCTGGGGGCAGG - Intergenic
949855396 3:8456762-8456784 GTGAGCTTGGAGCTGGAGCCAGG - Intergenic
950422859 3:12908896-12908918 CAGGGAGTAGACCTGGAGCCAGG + Intronic
951527710 3:23669812-23669834 CTGGGCATGGGGCTGGAGCAGGG - Intergenic
953103835 3:39855966-39855988 CTGGGGCTTGAGCTGGAGACTGG + Intronic
953990874 3:47482404-47482426 CTGGGCAGTGGGCTGGAACCTGG - Intergenic
954435489 3:50493751-50493773 CCCGGCACAGAGCTGGAGGCGGG + Intronic
955536138 3:59925539-59925561 CAGGGGATAGACCTGGACCCTGG - Intronic
955943353 3:64167650-64167672 CTGGGCAGAAAGATGGAGGCTGG + Intronic
956042820 3:65163475-65163497 CTGGGCATTGACTAGGAGCCAGG - Intergenic
956754200 3:72369072-72369094 CTGGGCATCTACCAGGAGCCAGG + Intergenic
960052133 3:113249134-113249156 CTAGGCATAGAGCTGGGGTGAGG + Intronic
960543228 3:118883540-118883562 CTTGACATAGGGCTGGATCCAGG + Intergenic
961083922 3:124050273-124050295 CTGGGCAAAGGCCTGGAGTCAGG - Intergenic
961195828 3:125000640-125000662 CTGGGATAAGAGCTGGAGCTTGG - Intronic
961309986 3:125990484-125990506 CTGGGCCTAGAGCAGGAGAAAGG + Intergenic
961345973 3:126263641-126263663 CTGGGCACAGAAGTGGTGCCAGG + Intergenic
961484403 3:127207025-127207047 CAGGGCATCGAGAGGGAGCCAGG - Intergenic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
962290825 3:134134978-134135000 CTGGGCATGGAGCTGGGGGAGGG - Intronic
962369152 3:134806386-134806408 CTGGGACTTGAGCTGGAGCTGGG - Intronic
962734965 3:138317496-138317518 AGGGGCATAGAGCTGGACCATGG + Intronic
966246404 3:177812814-177812836 CTGGGCAGGGAGGAGGAGCCAGG + Intergenic
966816776 3:183896189-183896211 CTAGGCACAGAGCTGGATCCTGG - Intergenic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
967891196 3:194365724-194365746 CTCAGCATGAAGCTGGAGCCGGG - Intronic
968075269 3:195812716-195812738 CAGGGCAGGGAGCTGGAGCCAGG + Intergenic
968816636 4:2824893-2824915 CTGGGCATGGGGATGGAGCTGGG - Intronic
969666541 4:8560612-8560634 CTGTGCATGGAGCTGGAGAGAGG + Intronic
970001061 4:11366647-11366669 CTTGGCCTACAGCTGGGGCCTGG - Intergenic
970423435 4:15926003-15926025 CAGGGCACCCAGCTGGAGCCAGG - Intergenic
970518972 4:16863546-16863568 CTCTGCAAGGAGCTGGAGCCAGG + Intronic
972629127 4:40828439-40828461 CTGGGCACAGATCTGGAGATAGG - Intronic
973148267 4:46857120-46857142 AAGGGCACAGAACTGGAGCCTGG + Intronic
973548412 4:52005814-52005836 CTGGCTGTAGTGCTGGAGCCAGG - Intronic
973568007 4:52207758-52207780 CTGGGAAGAGGGCTGAAGCCAGG + Intergenic
983929563 4:173438349-173438371 GTGGGCAGATAGCTTGAGCCCGG - Intergenic
984425771 4:179583442-179583464 CTGGGCATTTAGCTGAAGACAGG - Intergenic
984462671 4:180057934-180057956 CTGGGCGTAGACCCGGAGACCGG - Intergenic
985524265 5:394186-394208 CTGAGCACAAAGCTGCAGCCTGG - Intronic
986110335 5:4709804-4709826 CTGGGAAGAGGGCTGAAGCCAGG + Intergenic
990819837 5:59825767-59825789 CAGGGCAGAGACCTGCAGCCAGG + Intronic
991960909 5:72043187-72043209 CTGGCCAGAAAGCTGGAGTCAGG + Intergenic
995708834 5:115014394-115014416 CTAGGGATAGAACTGGATCCAGG - Intergenic
995825623 5:116295517-116295539 GTGGGCAGATTGCTGGAGCCCGG + Intronic
996221691 5:120940567-120940589 CAGGACATAGAGCTGGAGAGAGG + Intergenic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
998166489 5:139847360-139847382 CTAGGCTTGGAGCTGGAGCTGGG - Intronic
998402595 5:141855776-141855798 CTGGGCAGGGAGCTGGGGCAAGG - Intronic
999436371 5:151566623-151566645 TTTGACATAGAGCTGGAGACAGG - Exonic
1000018758 5:157301067-157301089 CAGGGCATAGAGCTGGGCCTTGG + Intronic
1000240839 5:159406678-159406700 CTGGGGATAGAGTAGGAGCACGG - Intergenic
1001926087 5:175638301-175638323 CTGGGCATAGGGATGGCGCATGG - Intergenic
1002194563 5:177495007-177495029 CTGACCAGGGAGCTGGAGCCCGG + Intronic
1002418724 5:179134722-179134744 CTGGAGCTGGAGCTGGAGCCGGG - Intronic
1002563833 5:180099307-180099329 CTGGCCATGACGCTGGAGCCAGG + Intergenic
1003442839 6:6159465-6159487 CTGGACATGGGGCTGGAGCCAGG + Intronic
1003613291 6:7632309-7632331 ATGAGCACAGACCTGGAGCCCGG - Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007118249 6:39359677-39359699 ATGGGCAGAGTGCTTGAGCCTGG - Intronic
1007260237 6:40558311-40558333 CTGGGCACAAAGCTGCAGGCAGG - Intronic
1007776794 6:44228499-44228521 CTGGCCAGAGTGCAGGAGCCTGG - Intronic
1008623020 6:53290439-53290461 ATGTGCATAGTGCTGGGGCCAGG + Intronic
1009957287 6:70471173-70471195 TTGGGCAGAGAGCTGGAGTTGGG + Intronic
1011555422 6:88567442-88567464 CTGGGCTTTGTTCTGGAGCCTGG + Intergenic
1013111703 6:107069769-107069791 CTGGGCACACTGCTGCAGCCAGG + Exonic
1013661907 6:112306630-112306652 CTGGGCACAGAGCAGGTGCTCGG + Intergenic
1015116443 6:129654762-129654784 CTGGGCAGAGAGGAGGATCCAGG - Intronic
1016614523 6:146030001-146030023 ATGGCTACAGAGCTGGAGCCGGG - Exonic
1016876595 6:148871366-148871388 CTGGGCATTGTGCTGGATCCTGG - Intronic
1017824073 6:158068870-158068892 GTGAGCATAGAGAAGGAGCCAGG - Intronic
1019322635 7:422583-422605 CTGGGCTTCGACCGGGAGCCAGG + Intergenic
1019500175 7:1360728-1360750 AAGGGCAGAGAGCTGGGGCCAGG + Intergenic
1019923940 7:4180176-4180198 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923946 7:4180201-4180223 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923951 7:4180226-4180248 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923957 7:4180251-4180273 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923963 7:4180276-4180298 CAGGGCATAGAGCTAGAGCCGGG - Intronic
1019923968 7:4180301-4180323 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923973 7:4180326-4180348 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923979 7:4180351-4180373 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923985 7:4180376-4180398 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923990 7:4180401-4180423 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923994 7:4180426-4180448 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019924000 7:4180451-4180473 CAGGGCATAGAGCTGGAGCCGGG - Intronic
1019924006 7:4180476-4180498 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019924011 7:4180501-4180523 CTGGACATAGAGCTGGAGCCAGG - Intronic
1019924015 7:4180526-4180548 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1020743799 7:12055582-12055604 GTGGGCATAGAGCTGGGGTCTGG - Intergenic
1021297779 7:18930167-18930189 CTGGACATAGAGATGGAACGGGG - Intronic
1022847134 7:34221620-34221642 CTAGGCATAGAGTTGGAGGTGGG + Intergenic
1023380821 7:39606559-39606581 CTGAGCATGGAGGTGGAACCGGG + Intronic
1024074654 7:45812321-45812343 CTGGGCCGAGAGATGCAGCCAGG + Intergenic
1024627471 7:51220352-51220374 CTGGCCATAGATTTGGAGCTGGG - Intronic
1025052313 7:55741560-55741582 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1025052707 7:55743108-55743130 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1025130291 7:56371344-56371366 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1025130611 7:56372642-56372664 CTGGGCCGAGAGATGCAGCCAGG - Intergenic
1026893390 7:73996259-73996281 CTGGGGTTAGAGCTGGACACTGG - Intergenic
1027174191 7:75892983-75893005 CTGTGCACAGAACTGGGGCCAGG + Intergenic
1028086734 7:86645101-86645123 CAGGGCATAGATCTGCGGCCAGG + Intronic
1029095557 7:98082509-98082531 CTGGCCAGAGAGCTGGGGTCCGG - Intergenic
1029710677 7:102297707-102297729 CTGGGCATACAGCAGGCGCTTGG - Intronic
1031528470 7:122849925-122849947 CTGGGCCAGGAGCTGGGGCCTGG - Intronic
1032080305 7:128855304-128855326 CTGGGCACAAACCTGGAGGCTGG - Exonic
1032360350 7:131249515-131249537 CTAGGCACTGAGCTGGAGGCTGG + Intronic
1034418024 7:150975295-150975317 CTGGGCCTAGAAAGGGAGCCTGG + Intronic
1034441656 7:151088704-151088726 CTGCTCATCAAGCTGGAGCCAGG - Intronic
1034561270 7:151880845-151880867 CTGGGGCTGGGGCTGGAGCCGGG + Intergenic
1034590283 7:152132532-152132554 CTGGGCACTGAGCTGGAGCACGG + Intergenic
1034880468 7:154758864-154758886 GTGGGACCAGAGCTGGAGCCTGG + Intronic
1034974239 7:155438692-155438714 AGGGGCAGAGAGCTGGAGACAGG + Intergenic
1035291842 7:157844319-157844341 CTGGGGATGGGGCTGGGGCCTGG - Intronic
1036434323 8:8719363-8719385 CTAAGAATAGAGCAGGAGCCAGG + Intergenic
1036590141 8:10161696-10161718 CTGGGGTCAGAGCTGAAGCCAGG + Intronic
1036634362 8:10538738-10538760 CAGGGGACAGAGCAGGAGCCAGG - Exonic
1036634727 8:10541019-10541041 GTGGGCATAGAACTCGAGCCTGG + Intronic
1037831384 8:22191788-22191810 CTATGAAGAGAGCTGGAGCCAGG + Intronic
1038748205 8:30272480-30272502 ACAGACATAGAGCTGGAGCCCGG - Intergenic
1038761170 8:30384951-30384973 GTGGGGCTGGAGCTGGAGCCGGG - Exonic
1040972513 8:53152172-53152194 CTTGGCATAGTGCTTGTGCCTGG - Intergenic
1042049928 8:64692402-64692424 CGGTGCACAGAGATGGAGCCCGG + Intronic
1044806915 8:96017736-96017758 ATAGGCATAGGGCTGGAGGCAGG - Intergenic
1045290188 8:100826263-100826285 CTGGGGCTGGAGCTGGAGCCCGG + Intergenic
1046887973 8:119389605-119389627 GTTGGCATAGAGCAGCAGCCTGG + Intergenic
1047953331 8:129953751-129953773 ATGGCCACAGAGCTGGAACCAGG + Intronic
1049164099 8:141116137-141116159 CTGGGGATGGAGCTGGGGGCTGG - Intergenic
1049175642 8:141190835-141190857 CTTGGCACAGAGCTGCAGCCTGG + Intronic
1049322615 8:142004885-142004907 CTGGGCCTGGAGCAGGTGCCCGG - Intergenic
1051657498 9:19396993-19397015 CTGGGCATATAGCTGGAGCTAGG + Intergenic
1052382352 9:27785161-27785183 CTGGAAACAGAGCTGAAGCCAGG - Intergenic
1053276937 9:36790314-36790336 CTGAGCAGAGCCCTGGAGCCAGG + Intergenic
1054149649 9:61591396-61591418 CTGGGAGGATAGCTGGAGCCTGG + Intergenic
1054469413 9:65522506-65522528 CTGGGAGGATAGCTGGAGCCTGG + Intergenic
1055385159 9:75753676-75753698 CTGGGTTTAGAGCTGGGGCTGGG + Intergenic
1055626225 9:78179635-78179657 CAGGGAACAAAGCTGGAGCCTGG - Intergenic
1056788573 9:89610704-89610726 CAGGCCAGAGAGCTGGCGCCAGG - Intergenic
1056856991 9:90140253-90140275 CTGGGCAGAGGGCTGAGGCCTGG + Intergenic
1057080714 9:92172599-92172621 CTGGGCACACTGCTGCAGCCAGG - Intergenic
1057307198 9:93919338-93919360 CTGGGCAGAGAGCTGGGGAGGGG - Intergenic
1058369111 9:104244231-104244253 CTGGGCATATAGATGTTGCCTGG + Intergenic
1058765268 9:108176319-108176341 CTGAGCATATAACTGGTGCCAGG - Intergenic
1058773541 9:108262511-108262533 CTGGGTATAGAGTTGGACCAGGG - Intergenic
1059052470 9:110941473-110941495 CTCGGCATAGTTCTGGACCCCGG - Exonic
1059068865 9:111113997-111114019 CTTAGCATAGAGCTGAGGCCAGG + Intergenic
1059377763 9:113899260-113899282 ATGGGCATAGAGTTTCAGCCTGG - Intronic
1059435500 9:114273580-114273602 GAGGGCATGAAGCTGGAGCCTGG - Intronic
1059437863 9:114287308-114287330 CTGGGCACAGGGCTCAAGCCAGG - Intronic
1061252014 9:129431999-129432021 CTGGGCCTGGAGCTGGGGCTAGG + Intergenic
1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG + Intronic
1062197622 9:135282958-135282980 CTGGGCCTGGAGCTGAGGCCAGG + Intergenic
1062372411 9:136246910-136246932 CTTGGCACAGAGCAGAAGCCAGG - Intergenic
1062405464 9:136394189-136394211 CTGGGCATAGGGCTCATGCCTGG - Intronic
1062633337 9:137477216-137477238 CTTGGAACAGAGATGGAGCCTGG - Intronic
1187253739 X:17622718-17622740 CAGGGCACAGAGCAGGATCCTGG + Intronic
1187887407 X:23902449-23902471 CTGGGCATCATGCTGGACCCTGG - Intronic
1193221524 X:78932074-78932096 CTTGGAATAAAGCTGGATCCAGG + Intergenic
1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG + Intronic
1198086265 X:133285654-133285676 GTGGCCATATGGCTGGAGCCAGG - Intergenic
1198382417 X:136096528-136096550 CTGGGACTAGAGCTGGAGAGAGG + Intergenic
1199933924 X:152552978-152553000 CAGGGCAGAGCTCTGGAGCCAGG - Intergenic
1200132484 X:153858479-153858501 CAGGGCTTAGATCTGCAGCCAGG + Intergenic
1201367850 Y:13228114-13228136 CTGGGCAGAGACTTGCAGCCAGG - Intergenic