ID: 1019925944

View in Genome Browser
Species Human (GRCh38)
Location 7:4191820-4191842
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019925937_1019925944 -3 Left 1019925937 7:4191800-4191822 CCCCACAGAGGAGGGAAGCGCCA 0: 1
1: 1
2: 2
3: 19
4: 176
Right 1019925944 7:4191820-4191842 CCATCTCCACAGGTGTGGCCGGG No data
1019925933_1019925944 18 Left 1019925933 7:4191779-4191801 CCATAGGAGAAGCTGGGCTATCC 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1019925944 7:4191820-4191842 CCATCTCCACAGGTGTGGCCGGG No data
1019925939_1019925944 -5 Left 1019925939 7:4191802-4191824 CCACAGAGGAGGGAAGCGCCATC No data
Right 1019925944 7:4191820-4191842 CCATCTCCACAGGTGTGGCCGGG No data
1019925938_1019925944 -4 Left 1019925938 7:4191801-4191823 CCCACAGAGGAGGGAAGCGCCAT No data
Right 1019925944 7:4191820-4191842 CCATCTCCACAGGTGTGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type