ID: 1019925997

View in Genome Browser
Species Human (GRCh38)
Location 7:4192160-4192182
Sequence CTGTGTCAGTTACAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019925995_1019925997 -2 Left 1019925995 7:4192139-4192161 CCTTAGTGTGCTTCGTAGATACT 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1019925997 7:4192160-4192182 CTGTGTCAGTTACAGATGGAAGG 0: 1
1: 0
2: 3
3: 12
4: 177
1019925994_1019925997 10 Left 1019925994 7:4192127-4192149 CCTCACAGTTGGCCTTAGTGTGC 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1019925997 7:4192160-4192182 CTGTGTCAGTTACAGATGGAAGG 0: 1
1: 0
2: 3
3: 12
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019925997 Original CRISPR CTGTGTCAGTTACAGATGGA AGG Intronic
901458174 1:9375889-9375911 CTGTCTCAGTGAAAGATGGGGGG - Intergenic
902690682 1:18108577-18108599 CTGTGTCAGTTACATGGAGAAGG + Intronic
905303146 1:36999170-36999192 GTGAGTCAGTTACACATGGAGGG + Intronic
907832175 1:58075385-58075407 CTGTGTCACTTCCAAGTGGAAGG + Intronic
907870897 1:58441847-58441869 CTGAGTCGGTAACAGATGGTTGG + Intronic
907975509 1:59427623-59427645 CTGTGACAGGTACAGAGGAAAGG - Intronic
909117708 1:71560153-71560175 CTTTGTCAGTTGCAGATAAAAGG - Intronic
912118562 1:106439157-106439179 TTCTGTCACTCACAGATGGAAGG + Intergenic
913684091 1:121215194-121215216 CTAACTCAGTTACAGAGGGAGGG - Intronic
914035930 1:144002809-144002831 CTAACTCAGTTACAGAGGGAGGG - Intergenic
914153528 1:145065136-145065158 CTAACTCAGTTACAGAGGGAGGG + Intronic
914996193 1:152545471-152545493 CTGTGCCAGTCTCAGATGAATGG - Intronic
916681374 1:167108251-167108273 CTGTGTCTCTAGCAGATGGAGGG - Intronic
917621686 1:176802484-176802506 GAGTGTCAGGGACAGATGGAGGG + Intronic
918665361 1:187144286-187144308 CTATGTCAGTGACAGATGTGTGG - Intergenic
920471395 1:206233686-206233708 CTAACTCAGTTACAGAGGGAGGG - Intronic
922022808 1:221721443-221721465 CTGTGTGAGTTACAGCTGGATGG - Intronic
924075927 1:240336690-240336712 CTGTGTTAGTAACAGAAGAATGG + Intronic
924125677 1:240848535-240848557 CTGTGTAAGATACAAATGTAAGG + Intronic
1063855266 10:10243329-10243351 ATTTGTCAGTTACTGATAGAGGG - Intergenic
1065173667 10:23056346-23056368 CTGTGTCATTTACAGCTTAAGGG + Intergenic
1067159378 10:43810422-43810444 CTGAGTCAGTCACAGGTGGAAGG + Intergenic
1072002950 10:91215716-91215738 CTCTGCCAGTTACAAATGAATGG - Intronic
1072762911 10:98072533-98072555 CTGTCACAGTTACAGATGATTGG + Intergenic
1073902370 10:108237872-108237894 ATGTGTCAGTCACAGATGCTTGG - Intergenic
1074168518 10:110908672-110908694 TTGTGTCAGGTACAGATGATGGG + Intronic
1075167551 10:120082782-120082804 CTGTTTCATTAACACATGGAGGG + Intergenic
1077045239 11:541770-541792 CTGTGTCAGGTACAGGCAGAGGG + Intronic
1080274188 11:30485568-30485590 CTGTTTTACTTACAGAAGGAGGG - Intronic
1080735704 11:35011828-35011850 CTTTGGCAGTAACAGATGGCTGG + Intronic
1082796306 11:57380523-57380545 CTGTATCAGCTAAAGAGGGAAGG + Intronic
1086079536 11:82889110-82889132 CTTTGTGAGGTACAGGTGGAAGG + Intronic
1087174813 11:95086996-95087018 GTGTGTCAGTCACTGATAGAGGG + Intergenic
1089468578 11:118702772-118702794 CTATGTCAATTACAAATGAAAGG + Intergenic
1089873094 11:121694323-121694345 ATGGGTCAGTTACAGTTAGATGG - Intergenic
1090751063 11:129746970-129746992 CTGTGGAAGTTGCAGATGGTGGG - Intergenic
1094256995 12:28443058-28443080 CTGTATCTGTTAAAGTTGGAAGG + Intronic
1096688848 12:53307160-53307182 CTGGGTCAGTATGAGATGGAAGG - Intronic
1101604031 12:106234312-106234334 CTGTGTCAGTCTCAGAAGTAAGG + Intergenic
1102515933 12:113446672-113446694 CTGTGTCAGATACCGATAGGGGG + Intergenic
1104486408 12:129154658-129154680 CTGGTTCAGTAACAGATGGTTGG + Intronic
1107820284 13:44279782-44279804 CTCTGTAAGTCATAGATGGAGGG + Intergenic
1108263559 13:48681683-48681705 CACTGTCAGTTACAGATGCTGGG - Intronic
1111187663 13:84761157-84761179 CTGTGTCAGTAATAGATTTAAGG + Intergenic
1112989430 13:105494138-105494160 ATGTGTTAGTCACAGATGTAAGG + Intergenic
1113900337 13:113793424-113793446 CTGCGTGAGTTACAGAGAGATGG - Intronic
1114485919 14:23061571-23061593 CTGTCTTAGTTTCAGAGGGACGG + Exonic
1116282620 14:42928424-42928446 CTGGGTAAGTTACTGATGGGAGG + Intergenic
1117754649 14:58961040-58961062 CAGTGTTACTTGCAGATGGAAGG - Intergenic
1120148015 14:81000901-81000923 CTGTCTCACTTACAGCTGGCAGG + Intronic
1121601590 14:95208898-95208920 CTGAGTGAGTGACAGATGGGTGG - Intronic
1121999317 14:98633573-98633595 CTGTGTCAGAGACAGACAGAAGG + Intergenic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1123133542 14:106007330-106007352 CTGTTTCAGTCACAGCAGGATGG - Intergenic
1123435578 15:20251677-20251699 CTGTGACAGTGACAGAATGAGGG - Intergenic
1123763345 15:23449738-23449760 CTGTCCCTGTTGCAGATGGAAGG - Intergenic
1123929916 15:25161766-25161788 CTGTGTTATTGGCAGATGGAAGG + Intergenic
1125991288 15:44111221-44111243 CTGTCCCTGTTGCAGATGGAAGG - Intronic
1126872027 15:52999971-52999993 CTCTGTCATTTACAGCTGTAAGG - Intergenic
1127075661 15:55323003-55323025 GTGGGTCAGCTACAGATGGAGGG - Intronic
1130905995 15:88241314-88241336 CTGAGTGAGTGACAGAAGGAGGG + Intronic
1134610101 16:15601294-15601316 CTGGGTCAGTGTTAGATGGAGGG - Intronic
1134838319 16:17380547-17380569 AAGTGTCATTCACAGATGGAGGG + Intronic
1136386633 16:29930790-29930812 TTGTGTCAGTTACAGATATATGG - Intergenic
1137564407 16:49524432-49524454 GTGTGGCAGTGACAGATGGGTGG + Intronic
1140161747 16:72503286-72503308 CTATGTCAGTTAAACATAGAAGG - Intergenic
1140394500 16:74615140-74615162 CTGTGTGAAGTACAGAGGGAGGG + Intergenic
1146723180 17:35137530-35137552 CAGTGTCACTTACGCATGGAGGG + Exonic
1150187076 17:63194016-63194038 CTGCCTCATCTACAGATGGAGGG - Exonic
1151422733 17:74009160-74009182 CTGATTCAATCACAGATGGATGG - Intergenic
1152383536 17:79954942-79954964 CTTTGGCAGTCACGGATGGAGGG + Intronic
1154227534 18:12520843-12520865 CTGTCTCATTCACAGATTGAAGG - Intronic
1154281122 18:13004415-13004437 CTGTGTCAGTAAGAGAGGGTAGG + Intronic
1158772454 18:60536002-60536024 CTGTGTCAGTTAAAGCAGAATGG + Intergenic
1160127233 18:76187106-76187128 CTCTGTCAGTTACCAATGGCAGG - Intergenic
1161909803 19:7184610-7184632 CCGTGTGACTTACAGATGGTCGG + Exonic
1164139789 19:22448824-22448846 CTGCGTCAGTGGCAGATGGTAGG + Intronic
1165686522 19:37825859-37825881 CTGTGTTTTTTACAAATGGAAGG + Intergenic
1166263826 19:41663901-41663923 CTGTGGCAGTTCCACATGGCTGG + Intronic
1166961004 19:46495737-46495759 CTGTGTCAGGGAGAGAGGGAGGG - Exonic
1167260233 19:48454092-48454114 CAGAGTGAGTTCCAGATGGAAGG - Exonic
1167515856 19:49922832-49922854 CTGTGTCAGGCCCAGAGGGAGGG - Intronic
927633180 2:24792200-24792222 CTTTGTCAGTTACCCATGAAGGG + Intronic
928607577 2:32957746-32957768 CTGTGTTTCTTACAAATGGAAGG - Intronic
931405708 2:61976028-61976050 ATCTGTCAGTTACTGATAGAAGG + Intronic
933479995 2:82844271-82844293 CTTTGTCATTTTCAGAAGGAAGG + Intergenic
933875105 2:86612496-86612518 CTGTGGCAGTTACAAAGAGAGGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935890421 2:107671472-107671494 ATCTGTCAATTACTGATGGAGGG + Intergenic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
939664919 2:144939684-144939706 CTGTACCAATTACAGATGAAGGG - Intergenic
941542228 2:166800948-166800970 CTGGGTCAGTTTCAGAAGGATGG + Intergenic
941743957 2:169066530-169066552 ATGTGTCTGTCACAGAGGGAGGG - Exonic
942281465 2:174368141-174368163 ATCTGTCAGTTACTGATAGAGGG - Intronic
942504758 2:176629862-176629884 TTGTGTCAGTTACAGCATGATGG + Intergenic
943815813 2:192252826-192252848 ATGTGTGAGTTACAGAGAGAAGG + Intergenic
944719487 2:202408584-202408606 CTGTGTCTGGTACAGAGGGGAGG + Intronic
946860254 2:223994434-223994456 CTGTGGCAGTTACTGATGGCAGG - Intronic
1170454091 20:16516570-16516592 CTCTGTCAGCTCCAGATGAAGGG + Intronic
1170525819 20:17236755-17236777 CTGTCTCAGTTTCAGATTAAAGG + Intronic
1172185740 20:33030011-33030033 TTGAGTCAGTGATAGATGGATGG + Intergenic
1173185247 20:40835585-40835607 CTGTGTCAGAGGCAGATGCATGG + Intergenic
1174153446 20:48501938-48501960 CTGTGTCAGTTGAAGTTTGAGGG - Intergenic
1174984927 20:55440408-55440430 CTGTGTCAAATACAGCTGGTAGG + Intergenic
1175322322 20:58097900-58097922 ATGTGTCAATAACATATGGAGGG - Intergenic
1176677731 21:9795486-9795508 CTGTGTCCGTATCAAATGGAGGG + Intergenic
1177758162 21:25372466-25372488 CTGTGTGAATTAGAGGTGGATGG + Intergenic
1177993732 21:28070580-28070602 TTTTGACAGTTAAAGATGGAGGG - Intergenic
1181847356 22:25722415-25722437 CTGTTTCTGTGACAGAGGGATGG - Exonic
1182130644 22:27847952-27847974 CAGGGTCAGTCACAGGTGGAAGG - Intergenic
1182240898 22:28915287-28915309 CACAGACAGTTACAGATGGAAGG - Intronic
1183040108 22:35171594-35171616 CTGTGTGAGCTACAGATGGAAGG + Intergenic
1184243536 22:43223904-43223926 CTGTGTGGGTTACAGAAGGGAGG - Intronic
951576505 3:24120143-24120165 CTCTGTCAGCTTCAGAAGGAAGG + Exonic
952248760 3:31628203-31628225 ATGTGTCAGTTAAAAATGGGGGG + Intronic
952352503 3:32553706-32553728 TTGTGTTAGTTACAGTTGGCAGG - Intronic
957119881 3:76076364-76076386 CTGTTTCAGTGACCGATGAAAGG + Intronic
958179654 3:90043561-90043583 CTGTGTCTGTTACAGACTTATGG - Intergenic
959943814 3:112106732-112106754 CTGTGGCAGTGACACATGGCAGG - Intronic
961036078 3:123642521-123642543 CTGTGCCAGTGACAGCTGGAGGG + Intronic
961165763 3:124762731-124762753 CTCTGTCAGTAAAAGCTGGAAGG + Exonic
965893213 3:173540533-173540555 ATGTGTCACTTCCAGGTGGAGGG - Intronic
966811231 3:183846702-183846724 ATGTGTCTGTTACTAATGGATGG - Intronic
967422167 3:189285387-189285409 CTGTGTGTTTTAGAGATGGAAGG + Intronic
968361701 3:198151858-198151880 CTGTGTGAGCAACAGAAGGAAGG - Intergenic
970029637 4:11660305-11660327 CTGTGTGATTTGCAGATGAAGGG - Intergenic
971577362 4:28292479-28292501 TTGTTTCAGTTACACAGGGATGG + Intergenic
976835704 4:89370702-89370724 ATGTGCCAGTTACTGTTGGAGGG - Intergenic
980889376 4:138797706-138797728 GTGTGTGAGTGACAGAGGGAGGG + Intergenic
982287393 4:153749226-153749248 CCTTGTCAGTTACAGAAGGATGG - Intronic
985930611 5:3054551-3054573 CTTCCTCAGTTACACATGGATGG - Intergenic
987701802 5:21409512-21409534 CTGGCTCAGTGACAGATGAAAGG + Intergenic
990376284 5:55173643-55173665 CTGTGTCAGCTATAGATGTGAGG + Intergenic
990938687 5:61177917-61177939 CTGTTTCAGTTTCAGATGGAGGG - Intergenic
995032624 5:107496568-107496590 CTGTGTCAGTGAGAGCAGGAAGG - Intronic
995151176 5:108847580-108847602 TTGTATCAGTTATTGATGGAAGG + Intronic
996377928 5:122834744-122834766 GTGTCTCAGTTACAGAAGGCTGG - Intergenic
996772091 5:127096752-127096774 CTCTTTCAGTTGCAGATGGCAGG + Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1003576496 6:7301264-7301286 TTGTTTAAGTTAGAGATGGATGG - Intronic
1004978928 6:21000562-21000584 GTGTGTCATGTACAGATGGAAGG - Intronic
1006338452 6:33432856-33432878 CTGTGTGAGATGCAGAGGGAGGG + Intronic
1007771017 6:44192441-44192463 CTGTGTCACTTACAGAAACAGGG - Intergenic
1010033540 6:71294429-71294451 CAGTGTGAGTCACAGAAGGAAGG + Intronic
1011008708 6:82678659-82678681 CAGTGCCAGCTACAGAAGGATGG + Intergenic
1012951002 6:105517956-105517978 CTGGGTCAGTAGCATATGGACGG - Intergenic
1014553878 6:122821974-122821996 CTGTGCCAGTGGCAGATAGAGGG + Intergenic
1015034507 6:128637049-128637071 TTTTGTCAGTGAGAGATGGAGGG - Intergenic
1019925997 7:4192160-4192182 CTGTGTCAGTTACAGATGGAAGG + Intronic
1020094804 7:5362303-5362325 CTGTGTCATTTATAAACGGAAGG + Intronic
1022185972 7:27969346-27969368 CTGTGTAATTTACAGTTGGTAGG - Intronic
1022489150 7:30803465-30803487 CTGTTTCAGGGTCAGATGGATGG + Intronic
1024135000 7:46397666-46397688 GTGTGTTTGGTACAGATGGATGG + Intergenic
1026934025 7:74241656-74241678 CTGTGTCAGAAAGAGAAGGATGG + Intronic
1027695257 7:81402727-81402749 GTGTGTCAGTGACAGACAGATGG + Intergenic
1028506621 7:91578655-91578677 CTGTGTCAGATGAAGCTGGAGGG - Intergenic
1028770789 7:94618332-94618354 ATGTGTCAGTGACTGATGGCTGG - Intronic
1029620102 7:101684951-101684973 CTGTATCACTTACAAATGGAGGG + Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033242737 7:139694226-139694248 CTGTGAGAGTTACAGGAGGATGG - Intronic
1033986430 7:147231320-147231342 AAGTGTCAGTCACAGATGAATGG - Intronic
1035160532 7:156947242-156947264 CTGTGTCACTAAATGATGGACGG + Intergenic
1037678789 8:21075546-21075568 CTGTACCTGTTACTGATGGAAGG + Intergenic
1037956577 8:23064976-23064998 CTCTGTCAGTCAAATATGGAGGG + Intronic
1039190759 8:34971602-34971624 CTGTGTCACTTACAGGAAGAAGG - Intergenic
1039734775 8:40319987-40320009 CAGATTCAGTTACAGATAGAAGG + Intergenic
1044468937 8:92542391-92542413 CTGAATGAGTTACAGAGGGAGGG - Intergenic
1044553431 8:93536811-93536833 CTGTGTCAGGAACAGATGCTTGG - Intergenic
1045004239 8:97903366-97903388 TTGTGTCAGTTCCACATGGAAGG + Intronic
1045189330 8:99867352-99867374 CTGAGGCAGCTACAGATGAAAGG - Intronic
1050689173 9:8205834-8205856 CTTTCTCAGTTACTGATGGTTGG - Intergenic
1050822882 9:9904137-9904159 CTGTGTCAGACAAAGATGGGTGG + Intronic
1052820839 9:33137021-33137043 CTGGGTCAGCTACGGAGGGAGGG - Intronic
1052847865 9:33353260-33353282 CTGTGTCAATGACAAATGGTAGG - Intronic
1053364089 9:37510748-37510770 CTGTGACAGTTCCAGATATAGGG - Intergenic
1055451358 9:76433775-76433797 CTGTGTCAGTACCAGATAGTAGG + Intronic
1058498203 9:105582864-105582886 CTGTTTCAGTTAGAGATGGCTGG + Intronic
1059023514 9:110600744-110600766 CTGTGTCTGAAACAGCTGGATGG + Intergenic
1060233811 9:121846349-121846371 ATCTGTCAGTTACTGATAGAGGG - Intronic
1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG + Intergenic
1189316657 X:40061673-40061695 CTGTGTAGGTCACAGAGGGAGGG - Intronic
1190365285 X:49687556-49687578 ATGTTTCTGTTACAGATGAAGGG - Exonic
1197441327 X:126494623-126494645 CTGTGGCTGTTCCAGATGCATGG - Intergenic
1197948511 X:131868001-131868023 ATCTGTCAGTTACTGATAGAGGG + Intergenic
1198573124 X:137979570-137979592 CTGTGTCTGTTAAAGATAAAAGG + Intergenic
1200938152 Y:8756385-8756407 CGGTGTCAGTGAAAGATGGCTGG + Intergenic
1202129979 Y:21600738-21600760 AGGTGTCAGTGACAGATGGCTGG + Intergenic