ID: 1019927526

View in Genome Browser
Species Human (GRCh38)
Location 7:4203112-4203134
Sequence GCCTCCTGCCTCTGCGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019927526_1019927530 -8 Left 1019927526 7:4203112-4203134 CCCTTCCCGCAGAGGCAGGAGGC 0: 1
1: 0
2: 1
3: 24
4: 205
Right 1019927530 7:4203127-4203149 CAGGAGGCCACGCCATAACCCGG 0: 1
1: 0
2: 0
3: 2
4: 79
1019927526_1019927537 21 Left 1019927526 7:4203112-4203134 CCCTTCCCGCAGAGGCAGGAGGC 0: 1
1: 0
2: 1
3: 24
4: 205
Right 1019927537 7:4203156-4203178 CCCCAGCGCCCAGCCACGCAAGG 0: 1
1: 0
2: 0
3: 52
4: 417
1019927526_1019927531 -2 Left 1019927526 7:4203112-4203134 CCCTTCCCGCAGAGGCAGGAGGC 0: 1
1: 0
2: 1
3: 24
4: 205
Right 1019927531 7:4203133-4203155 GCCACGCCATAACCCGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019927526 Original CRISPR GCCTCCTGCCTCTGCGGGAA GGG (reversed) Intronic
900562392 1:3313725-3313747 GCCTCCTGCCCCGGCGGGCCTGG + Intronic
900596542 1:3482690-3482712 GCTTCCTGACTCTGCCGGGAGGG - Intergenic
900919766 1:5662774-5662796 GCCTCCTGCCCCTGCTGGGAAGG - Intergenic
902779932 1:18698610-18698632 GCTTCCAGGCTCTGCGGGAAGGG - Intronic
904131809 1:28281062-28281084 GCCCTCTGCCTCTGTGGGCAGGG - Exonic
904211327 1:28888189-28888211 GCCTCCTCCTTCTGGAGGAAAGG - Intronic
905495319 1:38380413-38380435 ACCTCCTGCCCCTGCAGGGAGGG + Intergenic
908247370 1:62238425-62238447 GCCTCCTGCCTGGGGGAGAAGGG + Intronic
912215601 1:107607582-107607604 GTCTCCTGCCACTGCAGGAAAGG + Intronic
912580193 1:110714219-110714241 GCCTCCTTCCTCTGTGGCACTGG + Intergenic
912638402 1:111320371-111320393 GCCTTCTGGCACTGCGTGAATGG + Exonic
914240615 1:145850350-145850372 GCCTCCTGCTTCTCCTGCAAGGG - Intronic
916100310 1:161388653-161388675 GCCTCCTGCTCCTGAGGGAAAGG - Intergenic
917404266 1:174686492-174686514 GTCTCCAGCCTCTTAGGGAAGGG - Intronic
918159331 1:181882746-181882768 GCCTGCTGCCTCTGGGGGCAGGG + Intergenic
919597212 1:199578997-199579019 GACTGCTGCCTGTGGGGGAAGGG + Intergenic
919807176 1:201387017-201387039 GCCTCCAGCCTCTCCTGGATGGG + Exonic
919883790 1:201918141-201918163 GCCTTCTCCCTCTTCAGGAATGG + Intronic
921146263 1:212360778-212360800 GCCTCCCACCTCTGCCGGATAGG + Exonic
1062829112 10:593561-593583 GGCCCCTGCCTCTGCTGGAGAGG - Intronic
1063097411 10:2920722-2920744 GCCTCCTGGCCCTCCGGGAGTGG - Intergenic
1065286499 10:24192349-24192371 GCCACCTGCTTCAGTGGGAAAGG + Intronic
1067197575 10:44135519-44135541 GCCTTCTCCCACTGGGGGAAAGG + Intergenic
1067571599 10:47375848-47375870 GCCTCCTGCCTCTTCCAGGAGGG - Intronic
1068600249 10:58949185-58949207 GCCTCCTGCCACTGCGGAAGAGG - Intergenic
1069221777 10:65892393-65892415 GCCTCCTGCCTTTCTGGGAAGGG + Intergenic
1069534100 10:69240572-69240594 ACCTGCTGCCTCTGTGGGGAAGG + Intronic
1070550452 10:77486900-77486922 GCCTTCTCCCTCTGCAGAAAGGG + Intronic
1070919171 10:80173170-80173192 TGCTCCTGCCTCTGCTGGCAAGG + Intronic
1076650372 10:131982689-131982711 GCCGTCCGCCTCTGCGGCAAGGG + Intergenic
1076740264 10:132479366-132479388 GCCTTTTCCCTCTGTGGGAAGGG - Intergenic
1077077127 11:706874-706896 CCCTCCTGCCTCTCCTGGCAGGG - Intronic
1077195591 11:1278511-1278533 GCCTCCTGCACCTGCTGCAAAGG + Intronic
1078473428 11:11610090-11610112 TCTTCCTGCCTCTCCAGGAAAGG + Intronic
1081330518 11:41794293-41794315 GCCTCCTGGCCATGCTGGAAAGG + Intergenic
1081528523 11:43942879-43942901 GCCTCCGGCGTCTGCGGGGCCGG - Exonic
1083171328 11:60925270-60925292 GATTCCTGTCACTGCGGGAAAGG + Intronic
1083595334 11:63916208-63916230 GGCTCCTGCCTCTCCTGGATTGG - Intronic
1084555509 11:69873574-69873596 GCCTCCTGTCTTTGGGGGACTGG - Intergenic
1084604911 11:70166760-70166782 GCCCCCTGCCTTTTGGGGAAAGG + Intronic
1089981457 11:122776365-122776387 GGCTCCTGTCTCTTCTGGAAGGG - Intronic
1091613161 12:2029015-2029037 TCCTCCTACCTCTGGGAGAACGG - Intronic
1091791324 12:3273777-3273799 CCCTCCTGCCTGTGCGGGGCAGG + Intronic
1096732519 12:53625987-53626009 GCCTCCTTCCTTTGGGGGGAAGG - Intronic
1097029674 12:56081655-56081677 GCCTCCTGCCTCCCCAGGGAGGG - Intronic
1103409374 12:120699976-120699998 GCCTCTAGCCTCTCCTGGAAAGG + Exonic
1103447186 12:121001943-121001965 GCCTCCTGCCTCTACTGGGAAGG + Exonic
1104961256 12:132489682-132489704 GCCGCCCTCCTCTGCGGGACTGG - Exonic
1105462622 13:20606489-20606511 GTCTCCTTCCTCTGCTGGAGTGG + Intronic
1105866203 13:24461756-24461778 GCCTCCAGCTGCTGGGGGAAGGG + Intronic
1107411839 13:40165209-40165231 GCCTGCTGCCTCTGCTTTAAGGG - Intergenic
1108869979 13:54973004-54973026 GCCTCTTGGCAATGCGGGAACGG - Intergenic
1113755824 13:112809974-112809996 GCCCCCTGCCTGTGCGTGCACGG + Intronic
1117999980 14:61514094-61514116 GCCTACTGCCTCTGAAGAAAGGG + Intronic
1118857652 14:69636629-69636651 GCTACCTGCCTCTTCTGGAAAGG - Intronic
1119663236 14:76466026-76466048 CCCTCCTGGCTCTGCAGGCAAGG + Intronic
1119729502 14:76942040-76942062 GCCTCCTGGCTTTTCAGGAAAGG - Intergenic
1122491068 14:102116623-102116645 GCCTACTGCCACTGCGGAGAGGG + Intronic
1122658948 14:103281652-103281674 GCTCCCTCCCTCTGCTGGAAAGG + Intergenic
1122909962 14:104822728-104822750 GCCTCCTGCTTCTAGGTGAAGGG + Intergenic
1122941242 14:104982320-104982342 GCCTCCACCCTCTGCAGGCAGGG + Intergenic
1124614912 15:31234431-31234453 GCCTCCTGGCTCTGCTGAATTGG - Intergenic
1124663449 15:31570029-31570051 TCGTCCTGCCTCTGCAGGCAGGG + Exonic
1125723090 15:41854429-41854451 GCCTCGTGCATCTCAGGGAAAGG + Intronic
1127919474 15:63481997-63482019 TCCCCCTGCCTCTCCGTGAAAGG + Intergenic
1128361509 15:66964961-66964983 GCCTCCTCTCTCTGCGGCAGAGG + Intergenic
1129342262 15:74893678-74893700 GCATCCTCCCTCTCCTGGAAAGG + Intronic
1129638644 15:77351043-77351065 GCCTTCTGCCTCTGAAGGCAGGG - Intronic
1131419047 15:92288175-92288197 GCCTCCTGCCACTCCCGGGATGG + Intergenic
1132372751 15:101309565-101309587 GCCTCCTGCCTGTTCAGGAGTGG + Intronic
1132591686 16:728904-728926 CCCTCTTGCCGCGGCGGGAAAGG - Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132884873 16:2178280-2178302 GCCTCCTGCCCGCGCGGGAGGGG - Exonic
1133240397 16:4410935-4410957 GCTTCCTGCCTCTGTGGCAGAGG - Intronic
1133292896 16:4734466-4734488 GCGTCCTGCCTCTCCTGCAATGG - Exonic
1133563433 16:6970609-6970631 CCCTCCTGCCTCTTTTGGAAGGG + Intronic
1133772898 16:8878084-8878106 ACCTCCAGGCTCTGAGGGAACGG + Intergenic
1135105119 16:19642621-19642643 GCCTCCTTCCTCTCCTGGATTGG - Intronic
1136034205 16:27526446-27526468 GACTTCTGTCTCTGCGGGGAAGG + Intronic
1136153010 16:28364609-28364631 GCCTCCTCTGGCTGCGGGAACGG + Intergenic
1136210073 16:28750664-28750686 GCCTCCTCTGGCTGCGGGAACGG - Intergenic
1136522494 16:30805926-30805948 CTCTCCTGCCTCTTCTGGAAGGG + Intergenic
1137365497 16:47856000-47856022 ACATACTGCCTCTGCGGGCAGGG + Intergenic
1139923243 16:70472529-70472551 GCCCCCTGTCTCTGGGGGAGAGG - Exonic
1141608719 16:85169711-85169733 GGCTCCTGCTGCTGCAGGAACGG - Intergenic
1141687817 16:85580345-85580367 GCCTCCCGCTTCTCCAGGAAGGG - Intergenic
1142077490 16:88128611-88128633 AGCCCCTGCCTCTGCGGGAGGGG - Intergenic
1142324220 16:89403607-89403629 CCCTGCTGCCTCCCCGGGAAGGG + Intronic
1142711929 17:1728124-1728146 GCCTCCTGCCTCCTCGGGCCTGG + Exonic
1144011269 17:11150483-11150505 CTCTCCAGCGTCTGCGGGAATGG + Intergenic
1145002033 17:19312395-19312417 GCCTCCTGCCGCTGTGGCTACGG + Intronic
1146271549 17:31488566-31488588 CCCTCCTGCCCTTGCGGGATCGG + Intronic
1147911408 17:43858337-43858359 GCCTCCTGGCTCTGCGGGCTAGG + Intronic
1148208624 17:45794868-45794890 GCCTCCTGCCTCTGAGGTGCCGG + Intronic
1148225865 17:45897285-45897307 ACCTCCTGCCTTTGGAGGAAAGG + Intronic
1148236662 17:45973746-45973768 CCCTCCTGCCTCTGCTGTGAAGG + Intronic
1148466897 17:47870475-47870497 CCCTCCTGCCACTGAGGGAGAGG + Intergenic
1151578726 17:74965595-74965617 GCCTGTTGCCTCCGTGGGAATGG - Intronic
1151694763 17:75708690-75708712 CCCTCCTGACTCTGCTGGACAGG + Intergenic
1152199715 17:78938261-78938283 TCCACCTGCCTCCGGGGGAAAGG - Intergenic
1152524166 17:80878013-80878035 TGCTCCTGCCTCAGTGGGAAAGG + Intronic
1152725677 17:81944471-81944493 TCCTCCTGCCTCTGTCTGAAAGG - Intronic
1154303060 18:13211673-13211695 GCCTCCTCCCTCCACAGGAAAGG - Intergenic
1155162027 18:23203907-23203929 GCCTTCTGCCACTGAGGGGATGG - Intronic
1160084543 18:75763532-75763554 GCTCCCTTCCTCTGGGGGAAGGG + Intergenic
1160843016 19:1154836-1154858 CCCTGCTGCCTCTGAGGGACAGG - Intronic
1161455881 19:4369556-4369578 ACATCCTGCCTCTGAGGGGAGGG + Intronic
1161717117 19:5882370-5882392 GACTCCTGCCTCGACAGGAAAGG - Intronic
1163845926 19:19638047-19638069 GCCTCCTGCGCCTGGGGAAACGG + Exonic
1165808549 19:38596627-38596649 GCCTGGTGCCTCCGCGGGAACGG + Intronic
1167248639 19:48389788-48389810 GACTCCTGCGTCTGAGGGAGGGG - Intronic
1167597440 19:50435088-50435110 GACTCCTGCGTCTGAGGGAGGGG + Intronic
925405132 2:3601139-3601161 GCCCCCTGCCCGTGTGGGAAGGG - Intronic
925795711 2:7539944-7539966 GCCTGCTTTCTCAGCGGGAAAGG - Intergenic
926130716 2:10302175-10302197 GCCTCCTGGCTCTCGGGGAGGGG - Intergenic
926246159 2:11123607-11123629 GGCTCCTGCCTCAGCAGGACAGG + Intergenic
927888409 2:26732555-26732577 GTGTCCTGCCTCTGGGGGCAGGG - Exonic
930099458 2:47591700-47591722 GCCTACTGCCTCTGCAAGAGTGG + Intergenic
931851221 2:66252222-66252244 GCCTCCTGGCTCTCCGGGAGGGG - Intergenic
932827909 2:74958599-74958621 GCCTCCAGCCCGCGCGGGAAAGG + Exonic
933989350 2:87622609-87622631 GCCTCTTGCGTCAGTGGGAATGG + Intergenic
934616594 2:95775079-95775101 GCCTCCTTCCTCTCTGGGAAAGG + Intergenic
934644298 2:96049480-96049502 GCCTCCTTCCTCTCTGGGAAAGG - Intergenic
934654089 2:96108401-96108423 TCCTCCTCCCAGTGCGGGAAAGG - Intergenic
934837713 2:97605570-97605592 GCCTCCTTCCTCTCTGGGAAAGG - Intergenic
936304492 2:111328217-111328239 GCCTCTTGCGTCAGTGGGAATGG - Intergenic
936487210 2:112936341-112936363 ACTTCCTGACACTGCGGGAACGG + Intergenic
936530891 2:113276775-113276797 TCCTCCTGCCACCGCCGGAAGGG + Intronic
936747519 2:115596057-115596079 GCCTCCTGGCTATGCAGGAAAGG - Intronic
938942676 2:136182687-136182709 TCCTCCTGCCTCTGAGGGTAGGG + Intergenic
938964849 2:136379317-136379339 GACTCCTGCCTCTGGGGCAGTGG + Intergenic
942084637 2:172432574-172432596 GTCTTCTGCCTCTGAGGAAACGG + Intronic
946312846 2:218892491-218892513 GCCCCCTGCAGCTGCTGGAAAGG + Intronic
948137245 2:235645680-235645702 CCCACCTCCCTCTGCAGGAAGGG - Intronic
948604607 2:239126849-239126871 GCCCCCAGCCTCAGCTGGAAGGG - Intronic
1169469595 20:5872227-5872249 GCCTTCTGCCTCTGCGTGAATGG - Intergenic
1170711016 20:18791094-18791116 TTCTCCTGCCTCTGCTGCAAAGG - Intergenic
1172631001 20:36378087-36378109 TCCTGCTGCCTCTGAGTGAAAGG - Intronic
1173205877 20:40992713-40992735 TCCTACTGCCCCTGCAGGAAAGG - Intergenic
1174053142 20:47781173-47781195 GCCTCCTGGCCCTGGTGGAAGGG + Intronic
1175569700 20:60009550-60009572 CCCTCCTCCCTCTGCGGGGCAGG + Intronic
1175945281 20:62555716-62555738 GCCTCCAGCCGCTGCAGGAGGGG - Intronic
1176049584 20:63110817-63110839 GCCACCTGCCTCTGCAGGGTGGG + Intergenic
1176077546 20:63255111-63255133 GCCTCCTGCCTGCGCGGGAGGGG + Intronic
1177799408 21:25813062-25813084 ACATCCTACCTCTGCGAGAATGG + Intergenic
1178687392 21:34722538-34722560 GCCTTCTGCCTCTGTGAGGAAGG - Intergenic
1179791882 21:43760528-43760550 ACCTCCTGCCTCTGCCAGCAGGG + Exonic
1179983349 21:44907684-44907706 GCCTGCTGCCTCTACAGGGAAGG + Intronic
1183391095 22:37546092-37546114 GCCTCCGGCCCCAGCGGGACGGG + Intergenic
1183548588 22:38468370-38468392 GCCTCATGCCCCTGCGTGCAGGG + Intronic
950090237 3:10289865-10289887 GACTCCTTTCTCTGCTGGAAGGG + Exonic
950678189 3:14567327-14567349 GCCCCCTGCCTCTGCAGCATGGG + Intergenic
950710958 3:14812318-14812340 GCCTCCTGCCTGTGCTGGCGTGG + Intergenic
952301294 3:32106623-32106645 GCCGCCAGCCGCTGCGGGCAAGG + Exonic
952883158 3:37997986-37998008 GCCTTCTGTCTCTGAGGGACTGG + Intronic
954082380 3:48220168-48220190 GCCTCCTGGGTCTGCAGGAGAGG + Intergenic
954134483 3:48575677-48575699 GCTTCCTGCCTGTGCCCGAACGG - Exonic
954240270 3:49288211-49288233 GCCTGCTGCCTCTCGGAGAAGGG + Intronic
957858047 3:85904386-85904408 GCAGCCTGCCTCTTCTGGAAAGG + Intronic
960333557 3:116391423-116391445 GCCTGCTGCTGCTGCGGGGAGGG + Intronic
960575636 3:119226837-119226859 AGCTGCTGCCTCTGCAGGAAGGG + Exonic
966826783 3:183971632-183971654 GCCTTCTTCCTCTTCGGGACTGG + Exonic
967188289 3:186963971-186963993 GCCTCCTGCCCCTGCAAAAAAGG - Intronic
969414213 4:7048218-7048240 GGCTCCTGCCCCGGCGGGGAAGG - Intronic
969533180 4:7740665-7740687 GGCCCCGGCCTCTGCGGGGAAGG - Exonic
970168800 4:13268002-13268024 GCATCCTCCCTCTGCTGCAAGGG - Intergenic
970936340 4:21575112-21575134 GACTCCAGCCTCTGTGGGAGAGG + Intronic
971677934 4:29658508-29658530 GCTGCCTGCCTCTGCAGCAATGG + Intergenic
975683568 4:76898191-76898213 CCTCCCTGCCTCTGGGGGAAGGG + Intergenic
978061370 4:104344593-104344615 GCCTCCTGCCCCTGCAGGCTCGG + Intergenic
978706013 4:111712496-111712518 GCTTCCAGCATCTGAGGGAAAGG - Intergenic
982930967 4:161407410-161407432 GCCTCCTCCCTCTTCAGGATCGG - Intronic
984702113 4:182825255-182825277 GCCTCTTGCCTCTGGGGGCTGGG - Intergenic
985025768 4:185737657-185737679 GGCGGCTGCCTCTGCGGGGATGG + Intronic
985828111 5:2207742-2207764 GGTTCTTGCCTCTGCAGGAAAGG - Intergenic
985890616 5:2712562-2712584 GCCTCCTGCCACTGGGGGTGGGG - Intergenic
986652747 5:9980427-9980449 GACTCCTTCTTCTGAGGGAAGGG + Intergenic
986663610 5:10080869-10080891 GCCTCCAGACTCTGCGGTAAAGG + Intergenic
988835659 5:35029902-35029924 GCCCCCTGCCTCTGTTGGGAGGG + Intronic
992764995 5:79990740-79990762 GCCTTCTGCCTTTGGGGGATGGG - Intronic
993334897 5:86645374-86645396 GCCTGCTGGATCTGTGGGAAGGG + Intergenic
995537640 5:113153276-113153298 CCCTCCTACTTCTGGGGGAAAGG + Intronic
995861993 5:116650780-116650802 GCTTCATGGCTCTCCGGGAAAGG - Intergenic
996383368 5:122885116-122885138 GCTTCCTGCCTCTGTGAGAATGG + Intronic
998988728 5:147791428-147791450 GCCTCTGGCCTCTGCGTGTAAGG - Intergenic
1001301688 5:170538172-170538194 GCCTCCTGCCTATACTGGAGAGG - Intronic
1001436683 5:171704733-171704755 GGCTCCTGCCTCGGAGGGAGAGG + Intergenic
1002569163 5:180130265-180130287 GCCTGCTTCCTCTGCGGGGTAGG + Intronic
1003024455 6:2541923-2541945 GCCTCCTCTCTCTTTGGGAATGG - Intergenic
1005881065 6:30061376-30061398 GCCTCCTGCCTCTGCGACCAAGG - Exonic
1008545216 6:52577407-52577429 CGCTCCTTCCTCCGCGGGAAGGG + Intergenic
1008933803 6:56967674-56967696 GACTCCAGTCTCTGTGGGAATGG + Intronic
1017726960 6:157282888-157282910 GCCTCCTGCAGCTGCGGGAGAGG + Intergenic
1018134561 6:160767168-160767190 CCATCCTGGCCCTGCGGGAAGGG + Intergenic
1018423734 6:163662297-163662319 GCGTCCTTCCTCAGCGGGAGAGG - Intergenic
1018755849 6:166849271-166849293 GCCCCATGCCTCTGCTGGTATGG + Intronic
1019927526 7:4203112-4203134 GCCTCCTGCCTCTGCGGGAAGGG - Intronic
1020241457 7:6398314-6398336 CCCGCCTGCCTTTGCGGTAAGGG + Intronic
1023845719 7:44119098-44119120 GCCACCTGACTCCACGGGAATGG - Intronic
1027184582 7:75963303-75963325 GCCTCCCGCTGCTGTGGGAACGG + Intronic
1029853565 7:103489961-103489983 GCCTCCAGCCTCTGGGAGAGGGG + Intronic
1031905072 7:127451473-127451495 GCCTACTGCCTCTGTGGGCAGGG + Intergenic
1034491380 7:151394818-151394840 CACTCCTGCATCTGCAGGAAAGG + Intronic
1035126544 7:156611956-156611978 GCATCCTGGCTCTGGGAGAAGGG + Intergenic
1037373348 8:18203611-18203633 GCCTCCTGGCTATGCTGGGAAGG + Intronic
1037674200 8:21040275-21040297 GCCTCCTGCCTCAGCTGGTCTGG + Intergenic
1037748119 8:21662584-21662606 GCCTGCTTCCTCTGAGGCAATGG + Intergenic
1038411489 8:27362690-27362712 CCCTCCTGTCACTGCTGGAAGGG - Intronic
1038422611 8:27443054-27443076 GCATCCTGCCTGTGCAGTAAGGG - Intronic
1039470870 8:37813120-37813142 TCCTCCTGCCTCTGCCTGAGTGG - Intronic
1044115276 8:88327597-88327619 GCCCCCAGCTCCTGCGGGAAGGG + Intronic
1047526860 8:125641314-125641336 GCCTCCTGCCTCAGCCTGCAGGG - Intergenic
1049037288 8:140086508-140086530 TCCTGCTGCCTCTGGGGGATTGG + Intronic
1049209120 8:141377191-141377213 GCCTCCTATCACTGCGGGCAGGG + Intergenic
1049642592 8:143722217-143722239 GCCACCTGCCCCTGCTGGAGGGG + Exonic
1049687145 8:143943553-143943575 GCCTGCAGCCTGTGCGGGACAGG - Intronic
1050506495 9:6354183-6354205 GGCTCCTGCCCCTGCAGGAAGGG + Intergenic
1055859462 9:80730787-80730809 GCATCCTGCCTCTCAGGAAATGG - Intergenic
1056649904 9:88449913-88449935 GCCTCTTGGCTCTCAGGGAAGGG + Intronic
1057543015 9:95993442-95993464 ACCTGCTGGCTCTGTGGGAAAGG - Intronic
1058794386 9:108483794-108483816 GCCTCAGGCCACTGCAGGAAGGG + Intergenic
1059151615 9:111954444-111954466 TCCTCCTGCTGCTGAGGGAAGGG + Intergenic
1061432116 9:130537586-130537608 TCCTCCTGCCCCTGCGGCAGAGG + Intergenic
1062029672 9:134356526-134356548 GCCTCCTGTGTCAGCAGGAAGGG - Intronic
1062306065 9:135907641-135907663 GCCTACTGCGCCTGCGGAAAGGG - Intergenic
1189335449 X:40168354-40168376 GTCTCTTGCCTCTGCCGGGAGGG + Intronic
1193468991 X:81876565-81876587 GCCTACTGCCGCTGCGGGACAGG - Intergenic
1196329162 X:114448826-114448848 GCCTCCTGCCGCTGGGTGAGGGG - Intergenic
1198956523 X:142137161-142137183 GCCTCCTGGAACTGAGGGAAAGG - Intergenic
1199442200 X:147881028-147881050 GCCTCCTGGCCATGCTGGAAGGG + Intergenic
1200121860 X:153794869-153794891 GCCGCCTGCCTCTCGGGGGAAGG - Intronic