ID: 1019927722

View in Genome Browser
Species Human (GRCh38)
Location 7:4204450-4204472
Sequence CAAAATAAATAGTTGGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019927720_1019927722 -9 Left 1019927720 7:4204436-4204458 CCACACAGTTAGAACAAAATAAA 0: 1
1: 0
2: 4
3: 58
4: 666
Right 1019927722 7:4204450-4204472 CAAAATAAATAGTTGGTGTCAGG 0: 1
1: 0
2: 0
3: 23
4: 262
1019927718_1019927722 27 Left 1019927718 7:4204400-4204422 CCATTAACGGCAGGGTGGGCAGT 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1019927722 7:4204450-4204472 CAAAATAAATAGTTGGTGTCAGG 0: 1
1: 0
2: 0
3: 23
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019927722 Original CRISPR CAAAATAAATAGTTGGTGTC AGG Intronic
901244272 1:7716414-7716436 TAAAATAAATAGCTGGATTCTGG - Intronic
901353580 1:8621608-8621630 TAAAATAAAAAGTTGGTTTGGGG - Intronic
901608845 1:10480688-10480710 CAAAATAAAAAGTTGAGGCCAGG - Intronic
903610853 1:24611093-24611115 CAAAAAAAAAAGTTGGTGGGGGG + Intergenic
904639489 1:31913563-31913585 AAAAAAAAATAGATGTTGTCAGG - Intronic
906915186 1:50001986-50002008 CAAAATAAATTTTTGTTATCAGG - Intronic
907484909 1:54770778-54770800 CAAAAGAAGTTGTTGGTGGCTGG - Intergenic
907634020 1:56115205-56115227 CAAAATATATATTTTGTCTCTGG - Intergenic
910270932 1:85393103-85393125 CAAAATAAATATTTCGTTTGAGG - Intronic
910427155 1:87129556-87129578 AAAAAAAAAGAGGTGGTGTCAGG + Intronic
910560960 1:88590369-88590391 CAAAATAGAAAGTTGGTTTTTGG + Intergenic
910696365 1:90021942-90021964 GAAAATTAATAGTTGGGGGCTGG + Intronic
912447643 1:109750171-109750193 TAAAATAAATAGGTGGTTACTGG + Exonic
914698865 1:150112601-150112623 CTAAATATCCAGTTGGTGTCTGG - Intronic
915850808 1:159320429-159320451 CAAAATAAATATAGGGTGTGTGG - Intergenic
915853610 1:159355129-159355151 CAAAACAAAAAGTTGGTTTGTGG - Intergenic
917151794 1:171953716-171953738 TAAAATAAAGAATTGGGGTCAGG - Intronic
917221633 1:172736448-172736470 AAAAGTAAATAGTTTGTGGCAGG - Intergenic
917735498 1:177916418-177916440 ATAAATAAATAGTGGGTCTCTGG + Intergenic
919265515 1:195259275-195259297 CAAATAAGATAGTTGTTGTCAGG - Intergenic
921339373 1:214119283-214119305 TAAAAAAACTAGTTAGTGTCAGG - Intergenic
921669407 1:217909518-217909540 CAAAATAAGTATTTGGAATCAGG - Intergenic
923034101 1:230272138-230272160 AAAAATAATTATTTGGTCTCTGG - Intronic
923771087 1:236937916-236937938 AAAAATAATTAGCTTGTGTCAGG - Intergenic
1063393930 10:5669067-5669089 CAAAATAAATAGCTTGGGTGAGG + Intergenic
1065601387 10:27372645-27372667 TAAAATAAATAGCTTGTGCCAGG + Intergenic
1066501063 10:35995225-35995247 CAAAAGATGTAATTGGTGTCAGG + Intergenic
1070256796 10:74820028-74820050 CAAAATTAAAAGTTGGTGGCCGG + Intergenic
1071057630 10:81529587-81529609 GAAAATAATTAGTTGCTGTCAGG + Intergenic
1071833073 10:89391510-89391532 AAAAATAAAAAATTGTTGTCCGG - Intronic
1072482916 10:95827155-95827177 CAAAATAAATAATTGTTGGCTGG + Intronic
1072946441 10:99814018-99814040 CAAAATAAAAATCTGGTGTAGGG + Intronic
1075056741 10:119224360-119224382 ATAAATAAATAGTGGGTGACTGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1081148099 11:39589439-39589461 CAGAATGAAAAGTTGGTGTAGGG + Intergenic
1082977879 11:59092926-59092948 CAATATAGATTGTAGGTGTCTGG + Intergenic
1084068039 11:66716718-66716740 TAAAACAACTAGTTGGTGCCTGG + Intronic
1084765968 11:71308681-71308703 CCAAGGAGATAGTTGGTGTCAGG + Intergenic
1084838487 11:71824885-71824907 AAAAATAAATATTTTGTTTCAGG - Intergenic
1085078709 11:73615559-73615581 TATAATAAATAGGTGGTGGCTGG + Intergenic
1088333574 11:108678293-108678315 CAAAATAAATAACTGTTTTCAGG + Exonic
1088779986 11:113124629-113124651 CAAAATAAATAGTTATCATCAGG - Intronic
1088984745 11:114895795-114895817 CAAAATAGTTTTTTGGTGTCTGG - Intergenic
1089148090 11:116344937-116344959 GAAAATAAACAGATAGTGTCAGG + Intergenic
1091005088 11:131945847-131945869 TAAAATGAATAGATGGCGTCTGG + Intronic
1092400201 12:8169213-8169235 AAAAATAAATATTTTGTTTCAGG + Intronic
1092489088 12:8928740-8928762 TAAAATATATACATGGTGTCTGG - Intronic
1092682221 12:10996890-10996912 GAAAACAAATTGATGGTGTCTGG - Exonic
1092774649 12:11932020-11932042 CAAAATAGATAGTTCTTTTCAGG - Intergenic
1093582539 12:20799256-20799278 CAAAAAAAATAGTTCTTTTCTGG - Intergenic
1094415617 12:30212080-30212102 CAAAAGAAATAGCATGTGTCAGG - Intergenic
1096918997 12:55063776-55063798 AAAAATAAATATTTGGTATCAGG - Intergenic
1097432209 12:59524392-59524414 CAAGAGAAAAACTTGGTGTCTGG - Intergenic
1098067544 12:66635121-66635143 TAAAATACATAGTTTGGGTCAGG + Intronic
1098530845 12:71539921-71539943 CAAAAAATCTAATTGGTGTCTGG - Intronic
1098654209 12:73007721-73007743 CAAAAGAAATAATCAGTGTCAGG - Intergenic
1100289040 12:93196386-93196408 CAAAATAAAAAGTTGGGGTGGGG - Intergenic
1101820009 12:108176339-108176361 CAAAACAGATAGTGGTTGTCAGG - Intronic
1102185297 12:110942967-110942989 CAAAATAAAGAGTTGGGGGCAGG + Intergenic
1102628914 12:114259399-114259421 CCACATAAATAGTTGGTTCCTGG + Intergenic
1103072711 12:117957983-117958005 CAAAAAAATTAGCTGGTGTGGGG - Intronic
1106879562 13:34114533-34114555 AAGGATAAAGAGTTGGTGTCTGG + Intergenic
1110605924 13:77432514-77432536 AAATATAATTAGTTGGTGGCTGG + Intergenic
1111092755 13:83468336-83468358 CAAAATAAATATATGGAGACAGG + Intergenic
1111761737 13:92475107-92475129 GAAAATAAACAGTTGAAGTCAGG + Intronic
1113270410 13:108667748-108667770 CACAAAAAATAATTGGTGCCAGG + Intronic
1113836736 13:113332983-113333005 CAAAATAATAAATTGGCGTCTGG - Intronic
1114397568 14:22380604-22380626 AAAAAAAAATAGTTGGTCCCTGG + Intergenic
1116642550 14:47484081-47484103 CAAAATTAATAGTAGGTATATGG + Intronic
1116773668 14:49155673-49155695 AAAAATAATTATTTGGGGTCAGG + Intergenic
1117017108 14:51529058-51529080 CAAGATGAATAGTTGGTCTTGGG + Intronic
1118317419 14:64733673-64733695 CAAAATAAATATTTCCTGTCTGG - Intronic
1119812680 14:77536021-77536043 CAAAAGAAAAAGTTGGTTTGAGG + Intronic
1122992408 14:105243138-105243160 CAAAAAAATTAGTGGGTGTGAGG + Intronic
1123634056 15:22285565-22285587 CAAAATAAAAAGTTGGTTTGGGG + Intergenic
1124099038 15:26676188-26676210 CAAAATAAATAGTTGCAAGCAGG - Intronic
1125054749 15:35344682-35344704 CAAAATAAAAAGTAGGTAACTGG + Intronic
1127885746 15:63198900-63198922 CAAAAAAAAGAGTTTGTGTTGGG + Intronic
1128378806 15:67096172-67096194 CAATATAAGTGGTTGGTGTCAGG - Intronic
1130690718 15:86079551-86079573 CAAAATAAAGAGGTGGGGTGGGG + Intergenic
1133825169 16:9271908-9271930 CAAAATGAATAGCTGGTGGATGG - Intergenic
1135043263 16:19134262-19134284 AATAATAAAAAGTTGGAGTCTGG - Intronic
1139005675 16:62569037-62569059 TAAAAAAAATGTTTGGTGTCAGG + Intergenic
1139723694 16:68878390-68878412 CAAAATAAAAAGTTGGGGGGAGG - Intronic
1139927001 16:70494444-70494466 CATTTTAAATACTTGGTGTCAGG + Intronic
1140601764 16:76485055-76485077 CAAAATAATTAGTTAGAGTAAGG + Intronic
1141221670 16:82075402-82075424 CAAAATGAAAAGTTGGTTTCTGG + Intronic
1142778732 17:2163473-2163495 CAAAATGAAGATTTGGTGCCTGG - Intronic
1142818371 17:2446485-2446507 CAAAATCAATTGTTGGGGCCAGG + Intronic
1142833712 17:2568729-2568751 CCAAATAAATATTTGGATTCAGG - Intergenic
1143663743 17:8344082-8344104 AAAAATATACAATTGGTGTCGGG - Intronic
1144039924 17:11401636-11401658 CAATTTAAAAATTTGGTGTCTGG + Intronic
1144151057 17:12446876-12446898 TAAAACACACAGTTGGTGTCTGG + Intergenic
1148067696 17:44884594-44884616 CAAAATAAAGAGTTGAGGGCCGG + Intronic
1149937081 17:60818693-60818715 CAAATGAAAGACTTGGTGTCTGG - Intronic
1151111483 17:71683058-71683080 GAAAAGAAATAATTGGGGTCAGG + Intergenic
1151516596 17:74600157-74600179 CAAAAAACATAAATGGTGTCAGG + Intergenic
1151809457 17:76429245-76429267 CAAAATAAAAAGTTGGGCTGGGG + Intronic
1152986125 18:322896-322918 CAAAATACACATTTGGTGTGGGG - Intronic
1156623709 18:38883674-38883696 TAAAATAAATAATTGGGGCCTGG - Intergenic
1156963732 18:43064794-43064816 AAAAATAAATAGTTATTGTGAGG - Intronic
1157070698 18:44404722-44404744 CAAAAAAGATAATTGGTGGCAGG - Intergenic
1157936499 18:51878981-51879003 AAAAATAAATAGTTGGTAGGTGG - Intergenic
1158325340 18:56307833-56307855 CAAAATAATTAATTTGAGTCTGG + Intergenic
1158683603 18:59592242-59592264 CAAAATAAATAGTTATTTTCAGG + Intronic
1158976125 18:62713159-62713181 TAGAACAAATAGTTTGTGTCGGG + Intergenic
1159324833 18:66901417-66901439 AAAAAAAAATATTTGATGTCTGG - Intergenic
1159572532 18:70134283-70134305 CAAAATAAAAAATTGGTGGTGGG + Intronic
1165885014 19:39071751-39071773 TACAATAAATAGTTGGGGCCAGG + Intergenic
1167048597 19:47065960-47065982 CAAAGGGAACAGTTGGTGTCTGG - Exonic
1168135002 19:54344967-54344989 TAAAAAAAAAAGTTGGGGTCAGG - Intergenic
1168431655 19:56286312-56286334 AAAAATAAAAAGTTTGGGTCAGG - Intronic
929135600 2:38620929-38620951 CAAAACAAATTGTTGTTCTCTGG + Intergenic
932646982 2:73512699-73512721 CAAAATACAGATTTGGTGGCCGG + Intronic
935521042 2:104105453-104105475 CAAAGTAAATAGATGGGGGCAGG + Intergenic
936841714 2:116777743-116777765 CAAAAAAAATAGTTTGTTTTAGG + Intergenic
936933965 2:117820010-117820032 CATATAAAATATTTGGTGTCAGG - Intronic
939069764 2:137525097-137525119 CAAAATAAATATTTGCTGTTTGG + Intronic
941370683 2:164659670-164659692 CCAAAGAACTATTTGGTGTCAGG + Intronic
941491708 2:166150489-166150511 CAAAATAACAAGTTAGTGTCAGG - Intergenic
942882341 2:180876175-180876197 CAAATTAAAAAGTTGGTTTTTGG + Intergenic
943405536 2:187478398-187478420 AAAAACAAATAGTTGATGTATGG + Intronic
944645523 2:201776600-201776622 CGGAATAAGTAGTTTGTGTCAGG - Intronic
945226374 2:207535151-207535173 AAAAATAAATAGTTTGTGACAGG + Intronic
945374206 2:209060262-209060284 CATAATAAATAGCTTGTTTCTGG + Intergenic
946728005 2:222681158-222681180 TAGAATACCTAGTTGGTGTCTGG - Intronic
948545367 2:238724815-238724837 CTAAATAAATACTGGATGTCAGG + Intergenic
1169239609 20:3965133-3965155 CAAAATAAAGAGTTCCTGCCAGG + Intronic
1169797048 20:9474238-9474260 CTAACTAAACAGTTGGTGTTTGG - Intronic
1172121138 20:32599433-32599455 TAAAATAAATGGATGGTTTCTGG + Intronic
1172336156 20:34117731-34117753 CTTAATAAATATTTGGTGGCTGG + Intergenic
1177314634 21:19441878-19441900 AAAAATAAAGAATTGGTGTTAGG + Intergenic
1178292364 21:31379834-31379856 CAAATTAAATGGTTGGGGTTGGG + Intronic
1178603780 21:34017399-34017421 AAAAAAAAAATGTTGGTGTCAGG + Intergenic
1181159406 22:20949056-20949078 CAAAATAGAAGGTTGGTGTGGGG + Intronic
1183298828 22:37048237-37048259 CAAGATAGATAGTTGGGGTGGGG - Intergenic
949103417 3:174168-174190 CAAAATAAAAGGTTGGTTTGGGG + Intergenic
949510769 3:4764927-4764949 AAAAATAAGTAGTGGGTGGCTGG + Intronic
949737161 3:7186921-7186943 CAAAGTTAATAATTGGAGTCTGG + Intronic
949978655 3:9484316-9484338 CAAAATAACTAGCTGGTATTTGG - Intergenic
950052596 3:10003732-10003754 CTAAATAAATAACTGGTGTTGGG - Intronic
950116656 3:10455068-10455090 CTCAATAAATATTTGGTGTTGGG + Intronic
952561920 3:34604712-34604734 AAAAATAAATAGGTGGTCACAGG - Intergenic
954217897 3:49134481-49134503 CAAAATAAATAGATGGGGCCTGG - Intergenic
955595935 3:60590616-60590638 CAAAATAAATATTTGTTGATTGG - Intronic
957254087 3:77814131-77814153 CAACAAAAATAGCTGGTCTCTGG - Intergenic
959169517 3:102828323-102828345 AAAAATACATAGGTAGTGTCTGG + Intergenic
959679017 3:109071570-109071592 GAAAAAAAATAGGTGGAGTCTGG + Intronic
963222080 3:142824124-142824146 CAAAATAAATATTTAGTGATGGG - Intronic
963454567 3:145527945-145527967 CAAAATAAAAAATTAGTGGCAGG + Intergenic
963891619 3:150641962-150641984 CAAAATGAAAAGTTGGTTTTTGG + Intergenic
963987644 3:151615908-151615930 CAAAATAAATATTTGGTAAGTGG - Intergenic
963987699 3:151616260-151616282 CAAAATAAATATTTAGTGCCAGG - Intergenic
964099569 3:152972695-152972717 AAAAAAAAAAAGTTGGTGGCCGG + Intergenic
964181378 3:153891111-153891133 CAAAATAAGTAGATGAGGTCTGG - Intergenic
964856981 3:161157152-161157174 TCAAATAAAAAGTTGGTTTCTGG - Intronic
964960948 3:162425406-162425428 CTAAATAACTAGTAGCTGTCAGG + Intergenic
965714502 3:171588090-171588112 CACAATGAATATTTGGTGTGAGG - Intergenic
966026745 3:175293151-175293173 CAAGATAATTAGTTGGAGTTAGG - Intronic
966154434 3:176900569-176900591 CTAAATAAATATTTGTTGTCGGG + Intergenic
969779908 4:9392369-9392391 AAAAATAAATATTTTGTTTCAGG - Intergenic
970186729 4:13462977-13462999 CAAGATCAATAGATGGGGTCAGG - Intronic
970604528 4:17666925-17666947 CAAAAAAAAAAGTGGGTGTAGGG - Intronic
971463850 4:26933196-26933218 AAAAAAAAAAAGTTAGTGTCTGG + Intronic
971571026 4:28210714-28210736 TAAAATATGAAGTTGGTGTCAGG - Intergenic
971736264 4:30456376-30456398 CAAAATAAATACTAGTTTTCTGG + Intergenic
972085678 4:35211346-35211368 CAAAAGATAGATTTGGTGTCTGG + Intergenic
972504629 4:39708812-39708834 CATAATAAGTAGTTGGTTTTTGG + Intronic
972715342 4:41640649-41640671 CAAAATGAAAAGTTGATATCAGG + Intronic
972807976 4:42549799-42549821 TAAAAAAAATAATTGGTGTTGGG + Intronic
974247638 4:59341244-59341266 CAAAATAATTAGTTGACATCAGG + Intergenic
975000058 4:69213200-69213222 CCAAATGAATAGTTGGTACCAGG - Intronic
976556897 4:86460773-86460795 CAAAATAAAGAGATGGGCTCTGG - Intronic
976610074 4:87021335-87021357 CAAGATAAATGAGTGGTGTCTGG - Intronic
978035605 4:103989523-103989545 TAAAATAAATTATTGGTGACTGG + Intergenic
978085096 4:104642044-104642066 AAAAATAAATACTTGGTTGCTGG - Intergenic
978588386 4:110297445-110297467 CAAAATAAAAAGCTGGTGAGGGG - Intergenic
978782643 4:112572893-112572915 CAAAATTAATAGATGTTGGCAGG + Intronic
979265883 4:118702428-118702450 CAAAATAAATATTTAGTAACAGG + Intronic
979357856 4:119726481-119726503 CAAAATTAAGTGTAGGTGTCAGG + Intergenic
981038130 4:140193533-140193555 CCAAATAAATAATATGTGTCAGG + Intergenic
984337289 4:178408913-178408935 CAAAAAAAACAGTGGTTGTCAGG + Intergenic
984666782 4:182437494-182437516 CAAAAAAAATAGCTGATGGCTGG + Intronic
987004813 5:13699416-13699438 AAAAATAAATACTTGGGGCCGGG + Intronic
987018531 5:13846132-13846154 TAAAATAAAAAGTTGGGGCCAGG - Intronic
987239329 5:15977947-15977969 AAAAATACATAGTTGGGGTGAGG + Intergenic
988111143 5:26822253-26822275 CTAAATAAATACTAGGGGTCAGG + Intergenic
988940876 5:36146013-36146035 AAAAATTAATAGCTAGTGTCAGG - Intronic
989587350 5:43085951-43085973 CAAAATTAAAAGTTAGTTTCAGG + Intronic
989995408 5:50823382-50823404 CTCAATAAATAGTGTGTGTCTGG + Intronic
991375984 5:65967716-65967738 CACAATAAATAATTGGTATAAGG - Intronic
991465084 5:66904242-66904264 AAAAATAAATAGTGGCTGCCAGG - Intronic
991528396 5:67589391-67589413 GAAAAGAAATAGTTGGTCTTTGG + Intergenic
991692835 5:69242137-69242159 CAAAATAAATAAGTGGTGCTGGG - Intronic
991721239 5:69495664-69495686 CAAAATAGACATTTGATGTCTGG + Intronic
992580169 5:78166438-78166460 CAAAAGAATTAATTGGTATCTGG - Intronic
992919907 5:81504018-81504040 AAAAATAAATATTGGGTATCAGG + Intronic
993025248 5:82637957-82637979 CAATATAAATAGATTCTGTCTGG + Intergenic
993916723 5:93752779-93752801 CATAATAAATAGTTGAAATCAGG - Intronic
994435297 5:99722211-99722233 CAAAATAAAAAGGTGGGGTATGG + Intergenic
995288156 5:110415480-110415502 AAAAAAAAAAAGTTGGGGTCGGG - Intronic
995373036 5:111441387-111441409 GAAAAGAAATAGTAGGAGTCAGG - Intronic
996659359 5:125982224-125982246 AGAAATAAAAATTTGGTGTCTGG - Intergenic
997221093 5:132165084-132165106 CAGAATAAGTAGGTGGTGGCGGG - Intergenic
998208772 5:140177921-140177943 CAAAATAACTATGTGCTGTCAGG + Intronic
998764928 5:145475898-145475920 AAAAATAATTATTTGTTGTCAGG + Intronic
999150661 5:149424057-149424079 GAAAATAAACAGTGGCTGTCTGG - Intergenic
999952068 5:156661982-156662004 AAAAATAAAAAGTTGGAGTGGGG + Intronic
1001285641 5:170421501-170421523 CATGATTAAGAGTTGGTGTCTGG + Intronic
1001719351 5:173843829-173843851 CAAAATAATCTGTTGTTGTCAGG - Intergenic
1004213028 6:13671607-13671629 CAAAATAGTTAGTTGCTGCCTGG + Intronic
1006200641 6:32286843-32286865 AAAAATAAATATATGATGTCAGG + Intergenic
1009446076 6:63743851-63743873 CAAAATAAACAGTTGAACTCTGG + Intronic
1010028105 6:71243308-71243330 AAAAAAAAATAGTTGTTGGCTGG + Intergenic
1010529188 6:76945675-76945697 CAAAAGAAAAAGTTGGTTTCTGG + Intergenic
1012149587 6:95730929-95730951 CAAAATCAATAATTGGATTCTGG + Intergenic
1013309171 6:108877711-108877733 CAAATTAAATAGCTCTTGTCTGG - Intronic
1013641382 6:112085989-112086011 AAAAATACATACTTCGTGTCAGG - Intronic
1014980131 6:127936287-127936309 AAAAATAAAAAATTGTTGTCTGG + Intergenic
1015844282 6:137503261-137503283 AATAATAAATAGTTGTTGACAGG + Intergenic
1016001258 6:139043768-139043790 CAAAATAAATATTTTGTATAGGG - Intergenic
1017453766 6:154578981-154579003 CAAAAATAAAACTTGGTGTCAGG - Intergenic
1019925423 7:4188796-4188818 AAAAATCAATAGATGGTTTCGGG - Intronic
1019927722 7:4204450-4204472 CAAAATAAATAGTTGGTGTCAGG + Intronic
1020920684 7:14260167-14260189 CAAAATAAATAATTCATGTTGGG + Intronic
1021498250 7:21299980-21300002 AAAAATAAATAAATGGTGTTCGG - Intergenic
1021658483 7:22895204-22895226 CAAAATAAGGAGTTGGGGTTGGG - Intergenic
1023941840 7:44773360-44773382 TAAAATAAAGAGTTGGGGCCGGG - Intergenic
1026398939 7:69989496-69989518 CGTAATAAATATTTGGTGTGTGG + Intronic
1026837896 7:73650217-73650239 CAAAACAAATAAATGGTGTGTGG - Intergenic
1027040633 7:74959046-74959068 CAAAAAAAATAGCTGTTGTCTGG - Intergenic
1027083003 7:75243311-75243333 CAAAAAAAATAGCTGTTGTCTGG + Intergenic
1027739292 7:81979847-81979869 CTGAATAAATACTTGGTGACTGG - Intronic
1030478197 7:110065286-110065308 CATAATAAATCATTGGTGGCAGG - Intergenic
1031828158 7:126591830-126591852 CAAAACTAAGAGTTGGTTTCTGG + Intronic
1032508371 7:132452856-132452878 CAGAGTAAATAATTGGTGTGTGG - Intronic
1032996818 7:137456034-137456056 CAAAATAAACTGTTGGTCCCCGG - Intronic
1036344002 8:7943993-7944015 AAAAATAAATATTTTGTTTCAGG + Intronic
1036424068 8:8627138-8627160 CATACTAAAGAGCTGGTGTCTGG - Intergenic
1036472730 8:9065189-9065211 TACTATAGATAGTTGGTGTCAGG - Intronic
1036839345 8:12104760-12104782 AAAAATAAATATTTTGTTTCAGG + Intronic
1036861133 8:12351003-12351025 AAAAATAAATATTTTGTTTCAGG + Intergenic
1037081777 8:14796631-14796653 CAAAATAAGTAGAGAGTGTCAGG - Intronic
1037273519 8:17155736-17155758 AAGAATAAATAGTTGGTGGAAGG + Intergenic
1038955211 8:32460671-32460693 AAAAACAAATTGTTGTTGTCTGG - Intronic
1040877780 8:52170855-52170877 CAAAATATATAATTTGTTTCTGG + Intronic
1041261300 8:56022624-56022646 AAAAATAAATAGCTGGGGGCCGG - Intergenic
1041733294 8:61084540-61084562 CAAAATAAATCTTTGTTGTGAGG - Intronic
1042286871 8:67123191-67123213 CAAGAATAATAGTTGGAGTCCGG - Intronic
1042539437 8:69893367-69893389 CCTAAAAAATAGTTGCTGTCTGG - Intergenic
1043163679 8:76876360-76876382 GAAAATAGATAGTGGGTGCCAGG - Intergenic
1043211041 8:77518210-77518232 AAAAATAAATATCTGGTTTCTGG + Intergenic
1045837612 8:106541361-106541383 GAAAATAAATGATTTGTGTCAGG - Intronic
1046291749 8:112171412-112171434 CAAAATAAATTGTAGGCATCAGG - Intergenic
1046529771 8:115428626-115428648 CAAATTGCATATTTGGTGTCAGG - Intronic
1047832733 8:128654360-128654382 TAATATAAATGGTTGGAGTCAGG + Intergenic
1051742946 9:20268839-20268861 CAAAATAAATGGTATGTGTGTGG + Intergenic
1052244801 9:26321478-26321500 CAAAATAAAGATTTGATCTCTGG - Intergenic
1052774979 9:32724136-32724158 CACAATAAATAGTTGCTTTATGG - Intergenic
1053375212 9:37600374-37600396 CAGAATAAATAGGAGGTGGCCGG - Intronic
1053395832 9:37773538-37773560 CAAAGTAAAAAGTTAGGGTCGGG + Intronic
1054857031 9:69911643-69911665 CAAAATAAATATTTGTTGAGTGG + Intergenic
1055261809 9:74445683-74445705 CTAAATAAATATTTGATGACTGG - Intergenic
1055472608 9:76628239-76628261 CAAAATAAATACTTGGAGCTGGG - Intronic
1058408365 9:104703154-104703176 ATAAATAAATAGGTGGTGGCTGG + Intergenic
1060886618 9:127159008-127159030 CAAAATAGGTAGTGGGTGTTAGG + Intronic
1187272752 X:17793579-17793601 CAAAACAAAGACTTGGTCTCTGG - Intergenic
1187583200 X:20631203-20631225 AAATGTAAATGGTTGGTGTCAGG + Intergenic
1188426756 X:30056991-30057013 CAAAACAAAAAGTTGGTTTTTGG - Intergenic
1190199244 X:48345872-48345894 CAAAATAAAAACTGGGGGTCAGG + Intergenic
1190805958 X:53836950-53836972 CAAAACAAAGAGTTGGTTTTTGG - Intergenic
1190829185 X:54044816-54044838 CAAAATTAATAGGTGGCGGCGGG + Intronic
1193845282 X:86462636-86462658 CATAATATATATTTGGTGTTTGG + Intronic
1193986517 X:88248222-88248244 CATAATAAATAATAGGTATCTGG - Intergenic
1196051301 X:111308270-111308292 GAAAACAAAAAGTTGGTCTCTGG + Intronic
1196246026 X:113401581-113401603 CAAAATTATTAGTTGGTGTGTGG + Intergenic
1198011926 X:132565411-132565433 GAAAAGAAATAGGTGGGGTCTGG + Intergenic
1198547207 X:137704999-137705021 GAAAATCAATAGTGGTTGTCAGG - Intergenic
1198594325 X:138219840-138219862 CAAAAAAAATTGCTGGTGACTGG + Intergenic
1199287491 X:146069898-146069920 CAAAACACAGATTTGGTGTCTGG - Intergenic
1201760275 Y:17529679-17529701 CTATAAAAATAGTTGGTGACTGG + Intergenic
1201841279 Y:18376311-18376333 CTATAAAAATAGTTGGTGACTGG - Intergenic
1202305434 Y:23465233-23465255 CAAAATAAAAAGTTGGTTTGGGG + Intergenic
1202375557 Y:24232585-24232607 CATAATAAAAAGCTGGTGTTAGG + Intergenic
1202495223 Y:25437534-25437556 CATAATAAAAAGCTGGTGTTAGG - Intergenic
1202565375 Y:26205356-26205378 CAAAATAAAAAGTTGGTTTGGGG - Intergenic