ID: 1019927993

View in Genome Browser
Species Human (GRCh38)
Location 7:4205928-4205950
Sequence GGTCCCACGTGACCTCCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019927993_1019927999 3 Left 1019927993 7:4205928-4205950 CCAGCTGGAGGTCACGTGGGACC 0: 1
1: 0
2: 3
3: 12
4: 133
Right 1019927999 7:4205954-4205976 CACCCCCGGAGAGCCAGAATGGG 0: 1
1: 0
2: 0
3: 6
4: 67
1019927993_1019928006 22 Left 1019927993 7:4205928-4205950 CCAGCTGGAGGTCACGTGGGACC 0: 1
1: 0
2: 3
3: 12
4: 133
Right 1019928006 7:4205973-4205995 TGGGAACATCCAAGGCTACAAGG 0: 1
1: 0
2: 0
3: 16
4: 229
1019927993_1019928004 14 Left 1019927993 7:4205928-4205950 CCAGCTGGAGGTCACGTGGGACC 0: 1
1: 0
2: 3
3: 12
4: 133
Right 1019928004 7:4205965-4205987 AGCCAGAATGGGAACATCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 194
1019927993_1019928007 27 Left 1019927993 7:4205928-4205950 CCAGCTGGAGGTCACGTGGGACC 0: 1
1: 0
2: 3
3: 12
4: 133
Right 1019928007 7:4205978-4206000 ACATCCAAGGCTACAAGGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1019927993_1019927998 2 Left 1019927993 7:4205928-4205950 CCAGCTGGAGGTCACGTGGGACC 0: 1
1: 0
2: 3
3: 12
4: 133
Right 1019927998 7:4205953-4205975 CCACCCCCGGAGAGCCAGAATGG 0: 1
1: 0
2: 0
3: 8
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019927993 Original CRISPR GGTCCCACGTGACCTCCAGC TGG (reversed) Exonic
900406045 1:2493494-2493516 GGCCCCACGTGCACTGCAGCAGG - Intronic
900503944 1:3019850-3019872 GGCCTCAGGTGACCTTCAGCAGG + Intergenic
901530749 1:9851059-9851081 GGCCCCAGGTGACCTGGAGCAGG + Intronic
905207624 1:36351913-36351935 GAGCCCATGTGCCCTCCAGCTGG - Intronic
906203503 1:43974891-43974913 GGTACCACGTGACCCCACGCCGG - Exonic
910655716 1:89616061-89616083 GGTCTCACTTGGCCACCAGCAGG - Intergenic
913286588 1:117232290-117232312 GGGGCCACTTGACCTGCAGCTGG + Intergenic
914519408 1:148402281-148402303 GGTCCCACTTGGCAGCCAGCTGG - Intergenic
914667395 1:149842440-149842462 CATCCCTCGTCACCTCCAGCTGG - Exonic
914668372 1:149851350-149851372 CATCCCTCGTCACCTCCAGCTGG + Exonic
914673139 1:149887211-149887233 CATCCCTCGTCACCTCCAGCTGG + Exonic
917170308 1:172165577-172165599 GCTCCTCCCTGACCTCCAGCAGG + Intronic
921361855 1:214337392-214337414 TGACCCAAGTGCCCTCCAGCAGG + Intergenic
922777003 1:228219421-228219443 TGTACCACGTCACCTCCATCTGG - Exonic
923055593 1:230424535-230424557 AGGCCCAAGGGACCTCCAGCTGG - Intronic
1064007165 10:11707915-11707937 GGTCCCCCTGGCCCTCCAGCAGG - Intergenic
1065852965 10:29805991-29806013 TATCCCAGGAGACCTCCAGCAGG + Intergenic
1067066051 10:43104909-43104931 GGCCCCGCGTGATCACCAGCCGG - Intronic
1069721314 10:70551307-70551329 AGTCCCAGGTGGCCTCCAGCAGG + Intronic
1072625892 10:97111727-97111749 GCTCCCAGGTGAGCTGCAGCAGG - Intronic
1074393954 10:113081678-113081700 GGTTCAATGTGACCTCAAGCAGG - Intronic
1074981954 10:118627006-118627028 GGGCCCCATTGACCTCCAGCTGG - Intergenic
1075488729 10:122848106-122848128 GGGGACAGGTGACCTCCAGCTGG + Intronic
1075835994 10:125453332-125453354 GGTCCCACGTGGGCTCCAGTAGG + Intergenic
1076346919 10:129785582-129785604 GTCCCCACGTGGCCTACAGCTGG - Intergenic
1077049144 11:558940-558962 GGTCACCTGGGACCTCCAGCAGG - Exonic
1077229300 11:1451430-1451452 GGTACCAGGAGGCCTCCAGCAGG - Intronic
1079010772 11:16826391-16826413 GGTCCCGCTTGCCCTCCAGTGGG + Exonic
1091771914 12:3157670-3157692 TTTCCCTTGTGACCTCCAGCAGG - Intronic
1095963490 12:47850880-47850902 ATTCCCACGGTACCTCCAGCAGG + Intronic
1099175727 12:79419411-79419433 GATCCCACCTGACCTGCTGCCGG - Intronic
1101292746 12:103388290-103388312 GGTCCCAACAGACCTCCAGATGG + Intronic
1104181481 12:126386078-126386100 GGTTTCACCTCACCTCCAGCAGG + Intergenic
1104282456 12:127390450-127390472 GGTCCCAGCTGAGCTCAAGCTGG + Intergenic
1104380443 12:128302981-128303003 GCCCCCACCTGACCTCCAGATGG + Intronic
1104761454 12:131299572-131299594 TGACCCACGTGGCCTCCAACAGG + Intergenic
1104818322 12:131661220-131661242 TGACCCACGTGGCCTCCAACAGG - Intergenic
1110149763 13:72237249-72237271 GTTCACACGTGACCTCCATTTGG + Intergenic
1113926160 13:113942884-113942906 GCTCCCACCTCACCTCCGGCGGG - Intergenic
1115779678 14:36755831-36755853 GGACCCACTTGGCCTCCAGAGGG - Intronic
1118616915 14:67580229-67580251 GGTACCACCTGACATCCAGGGGG - Intronic
1122724606 14:103742011-103742033 AGTCCCACGTACCCGCCAGCGGG - Exonic
1122920554 14:104878201-104878223 GGCCCCATGTGACCTCAGGCTGG - Intronic
1125538326 15:40455551-40455573 GGCCACCCCTGACCTCCAGCTGG - Intronic
1128731923 15:70027064-70027086 TGGCCCACCTGAGCTCCAGCTGG + Intergenic
1130519145 15:84648967-84648989 GAACCCACCTGACTTCCAGCGGG - Intronic
1131266070 15:90916124-90916146 GGTCCAAGATCACCTCCAGCTGG - Exonic
1132870738 16:2114733-2114755 AGGCCCAAGTGCCCTCCAGCTGG + Exonic
1134521791 16:14922171-14922193 AGGCCCAAGTGCCCTCCAGCTGG - Intronic
1134709461 16:16320822-16320844 AGGCCCAAGTGCCCTCCAGCTGG - Intergenic
1134716674 16:16360851-16360873 AGGCCCAAGTGCCCTCCAGCTGG - Intergenic
1134950142 16:18347823-18347845 AGGCCCAAGTGCCCTCCAGCTGG + Intergenic
1134958076 16:18391308-18391330 AGGCCCAAGTGCCCTCCAGCTGG + Intergenic
1136637936 16:31537582-31537604 GGTCCCAGGTGAGCTGCGGCCGG - Intergenic
1136666790 16:31819571-31819593 GGTCCCAGGTGAGCTGCGGCCGG + Intergenic
1141463960 16:84194933-84194955 AGTCCCCCCAGACCTCCAGCCGG + Exonic
1141710422 16:85695710-85695732 GCAACCACGTGACCTCCTGCAGG + Intronic
1142160110 16:88552962-88552984 CGTCACACGTGACCACCAGCCGG - Intergenic
1142190781 16:88716368-88716390 GGTCCGAGGTGCCCTCGAGCAGG + Exonic
1142203071 16:88770311-88770333 GGTCACACCTGCCCCCCAGCCGG + Intronic
1143563089 17:7706521-7706543 GGACCCAGGTGACCTCCCGAAGG - Intronic
1146488317 17:33261894-33261916 GGTCCCTCTTGGCCTCCATCTGG + Intronic
1146656637 17:34638561-34638583 GGGCCCACCTGACCCCAAGCTGG - Exonic
1150060748 17:62065983-62066005 GGGCCCACGTGACCTCAAGGCGG - Intergenic
1151551262 17:74823791-74823813 GGTCCGGCGTGACCTCCAGTAGG - Intronic
1151655032 17:75491845-75491867 GCTCCAACGTGAGCTTCAGCAGG + Exonic
1151897035 17:76987421-76987443 GGCCCCACGTGGACTCCTGCGGG - Intergenic
1152546720 17:81004043-81004065 GGTCCCACGGTCCCTCCCGCAGG - Intronic
1152705087 17:81839244-81839266 GCTCCCAGCTCACCTCCAGCAGG - Intergenic
1152869193 17:82742915-82742937 TGCCCCAGGTGACCTCCAGCTGG - Intronic
1153238970 18:3013551-3013573 AGTCCCACGTGACCTGCCGCAGG - Intergenic
1154277601 18:12975868-12975890 AGACTCACGTGACCTACAGCTGG - Intronic
1159673173 18:71249057-71249079 GGACCCTCGTCACCTGCAGCTGG - Intergenic
1160613958 18:80109713-80109735 GCTCCCACGTGACCGGCGGCGGG - Intronic
1163764158 19:19153122-19153144 GGTCCCACGAGAGCAGCAGCAGG + Intronic
1165319144 19:35075104-35075126 GGTCCCACATGGCCACCAGCAGG - Intergenic
1166287891 19:41843618-41843640 TGGCCGACGTGACCTCTAGCTGG - Exonic
1166937507 19:46343295-46343317 GGGCCCACATCACCTCCAGAGGG - Exonic
1167510880 19:49894855-49894877 GGTCCAACCAGACCTCCAGCTGG - Intronic
1167620266 19:50556491-50556513 GTTCCCACGACACCTCCAGGAGG + Intronic
926729616 2:16026376-16026398 GGTGCCACGTGACATTCAGGTGG + Intergenic
927633509 2:24794035-24794057 GGTCCCACGTCAGTTCCAGGAGG - Intronic
928224699 2:29438649-29438671 GATCCCACCTGACCTTCAGAGGG + Intronic
932708875 2:74047670-74047692 GTTCCCACGGGACCTCCAGCTGG - Exonic
934650545 2:96089158-96089180 GGACCCCAGTGAGCTCCAGCGGG + Intergenic
937110933 2:119366835-119366857 GGTCCCACGTGGGCTCGGGCGGG + Intergenic
941979069 2:171434696-171434718 TGTGCCAGGTGACCGCCAGCCGG + Exonic
945814831 2:214591554-214591576 TTTCCCAAGTGACCTCCAGAGGG - Intergenic
948902605 2:240964031-240964053 GGTCACAGGTGGCCTCCAGGAGG + Intronic
1169194389 20:3675386-3675408 GTTCCCAGGGGACCTGCAGCAGG + Intronic
1171354685 20:24534696-24534718 GGACCTAGGTGACCACCAGCAGG - Intronic
1174139151 20:48400666-48400688 GCTCCCGGGTGACCTGCAGCTGG - Intergenic
1176040781 20:63064749-63064771 GGTCCCCCATGACTTCCTGCTGG + Intergenic
1180984309 22:19895464-19895486 CCTCCCAGGTGACCTGCAGCTGG + Exonic
1183240889 22:36657509-36657531 CGGCCCCCGTGTCCTCCAGCCGG - Intronic
1183935239 22:41258142-41258164 AGTGCCAGGTGACATCCAGCAGG + Intronic
1184152961 22:42649198-42649220 GGTCCCGCGTCACCTCCCGCAGG + Intronic
1185043658 22:48518195-48518217 GATCCCACGTGGGCTCCTGCGGG - Intronic
950536304 3:13580984-13581006 TGTGCCACGTGGTCTCCAGCTGG + Intronic
950864177 3:16175613-16175635 GGACCCACGTGGCCTCCAGGAGG + Exonic
952845186 3:37682300-37682322 GGTCACCAGTGACCTCCAGAAGG + Intronic
954854823 3:53635214-53635236 TGTCACATGTGTCCTCCAGCAGG - Intronic
958025401 3:88042833-88042855 GGTCCCTCGTGAACCCCAGTAGG - Intergenic
960857422 3:122117450-122117472 TGTCCCACGTAAACTCCAACAGG - Intronic
963105676 3:141645193-141645215 GATCCCAGGTCACCTCCTGCCGG - Intergenic
968651240 4:1761100-1761122 GGGCCCACCTGACCTCCAGCCGG + Intergenic
969347486 4:6578525-6578547 GGTCCCTCAGGACCTCCAGTGGG + Intronic
981127790 4:141126615-141126637 GTTCCCATGTGCCCTCCAGTTGG - Intronic
985322622 4:188731655-188731677 GTTCCCATGTGACGTCCAGATGG - Intergenic
995277562 5:110294423-110294445 GGGCCCACTTGAGCTACAGCTGG - Intronic
999983080 5:156976502-156976524 GTTCCCACTTGAGCTCCAGTGGG + Intergenic
1002472999 5:179448417-179448439 GGTGCCAGGTGACCTCACGCAGG - Intergenic
1002481225 5:179502237-179502259 GGTGCCAGGTGACCTCACGCAGG + Intergenic
1003528360 6:6917134-6917156 GGTCCACTGTGATCTCCAGCAGG + Intergenic
1003540273 6:7012547-7012569 GGTCCCATGTGACCTACGACAGG + Intergenic
1004404366 6:15318288-15318310 GGATCCACGTGTCCTCCAGCTGG - Intronic
1005642386 6:27808446-27808468 CATCCCGCGTCACCTCCAGCTGG + Exonic
1005642962 6:27814482-27814504 CATCCCGCGTCACCTCCAGCTGG - Exonic
1006003647 6:30986321-30986343 GGTCCAGTGTGACCTCCAGTGGG + Exonic
1006003657 6:30986366-30986388 GGTCCAGCGTGACCTCCAATGGG + Exonic
1011545739 6:88479919-88479941 GGTCACCCGTGACCTCCACAGGG + Intergenic
1018096662 6:160393195-160393217 GGACCCAGGTGACCATCAGCTGG - Intronic
1019518751 7:1451198-1451220 AGCCCCACGTGACCTCCAGCTGG + Intronic
1019927993 7:4205928-4205950 GGTCCCACGTGACCTCCAGCTGG - Exonic
1021531126 7:21646636-21646658 GGTGCCCAGTGAGCTCCAGCAGG + Intronic
1026759269 7:73114245-73114267 GGACCCAAGTGTCCACCAGCAGG - Intergenic
1027088139 7:75279228-75279250 GGACCCAAGTGTCCACCAGCAGG + Intergenic
1029394247 7:100296386-100296408 GGACCCAAGTGTCCACCAGCAGG + Intergenic
1033440722 7:141375911-141375933 GGTCCCATATGAACTCCTGCAGG - Intronic
1034183150 7:149154190-149154212 CGGCCCACTTGCCCTCCAGCTGG - Exonic
1034196248 7:149250398-149250420 CGGCCCACTTGCCCTCCAGCTGG - Exonic
1034198588 7:149266580-149266602 CGGCCCACTTGCCCTCCAGCTGG - Exonic
1034227352 7:149494332-149494354 CGGCCCACTTGCCCTCCAGCTGG + Exonic
1034242530 7:149621388-149621410 CGGCCCACTTGCCCTCCAGCTGG + Intergenic
1035743422 8:1945398-1945420 GGGTCCACGTGGCGTCCAGCTGG - Intronic
1036828414 8:11999108-11999130 GGTCTCAAGTGAGCCCCAGCTGG + Intergenic
1037289307 8:17334735-17334757 GGTCCCAGATGACATCCACCAGG + Intronic
1039517567 8:38146372-38146394 GGTCCACCACGACCTCCAGCCGG + Exonic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049554430 8:143275035-143275057 GGCCCCACGTGGACTCCTGCCGG + Intronic
1052996995 9:34556341-34556363 TCTGCCACGTCACCTCCAGCCGG + Exonic
1055406006 9:75974255-75974277 GGACCGACGGGAGCTCCAGCCGG + Intronic
1059231623 9:112726161-112726183 GGGCCCACTTGAGCTACAGCTGG + Intergenic
1061387133 9:130296915-130296937 AGTCCCACTTGGCCTCCTGCAGG - Intronic
1062143079 9:134970942-134970964 GGTCTCTCGTCACCTCCAGGTGG + Intergenic
1203793348 EBV:163181-163203 GGTCCCAGGTCCCCTCCTGCAGG + Intergenic
1198549446 X:137729377-137729399 GGCCCCACCTCACCTCCAACAGG + Intergenic
1200158211 X:153989537-153989559 GGCCCCACTTGACCTCCACTGGG + Intergenic
1202018281 Y:20434992-20435014 GGTCCCACTTGTCCTCCAAGTGG + Intergenic