ID: 1019928822

View in Genome Browser
Species Human (GRCh38)
Location 7:4210166-4210188
Sequence AGACCCGGGGTTGGGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 282}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019928810_1019928822 -1 Left 1019928810 7:4210144-4210166 CCCTTGGCCCCTGTACAAGGTAA 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1019928822 7:4210166-4210188 AGACCCGGGGTTGGGGAGATGGG 0: 1
1: 0
2: 1
3: 23
4: 282
1019928814_1019928822 -9 Left 1019928814 7:4210152-4210174 CCCTGTACAAGGTAAGACCCGGG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1019928822 7:4210166-4210188 AGACCCGGGGTTGGGGAGATGGG 0: 1
1: 0
2: 1
3: 23
4: 282
1019928816_1019928822 -10 Left 1019928816 7:4210153-4210175 CCTGTACAAGGTAAGACCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1019928822 7:4210166-4210188 AGACCCGGGGTTGGGGAGATGGG 0: 1
1: 0
2: 1
3: 23
4: 282
1019928811_1019928822 -2 Left 1019928811 7:4210145-4210167 CCTTGGCCCCTGTACAAGGTAAG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1019928822 7:4210166-4210188 AGACCCGGGGTTGGGGAGATGGG 0: 1
1: 0
2: 1
3: 23
4: 282
1019928807_1019928822 27 Left 1019928807 7:4210116-4210138 CCTGCAGGGCTATCGGGTGGTGT 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1019928822 7:4210166-4210188 AGACCCGGGGTTGGGGAGATGGG 0: 1
1: 0
2: 1
3: 23
4: 282
1019928812_1019928822 -8 Left 1019928812 7:4210151-4210173 CCCCTGTACAAGGTAAGACCCGG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1019928822 7:4210166-4210188 AGACCCGGGGTTGGGGAGATGGG 0: 1
1: 0
2: 1
3: 23
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019928822 Original CRISPR AGACCCGGGGTTGGGGAGAT GGG Intronic
900105037 1:977778-977800 GTTCCCGGGGTTGGGGGGATTGG - Intronic
900105064 1:977836-977858 GTTCCCGGGGTTGGGGGGATTGG - Intronic
904762774 1:32817591-32817613 TGACTCGGGGTAGGGGAGGTCGG + Exonic
904768901 1:32870384-32870406 AGACCTGGGGTTAGGGGAATGGG + Intronic
905008563 1:34730962-34730984 TGGCCTGGGGTTGGGGAGATGGG - Intronic
905749524 1:40450189-40450211 TGTCCCGGGCTTGGGGAGCTGGG + Intronic
907248067 1:53120596-53120618 TGACCCAGGGTTGGGGACATTGG - Intronic
907297954 1:53467542-53467564 GGAGCCTGAGTTGGGGAGATTGG + Intergenic
908075164 1:60509337-60509359 AAACCAAGGGTTGGTGAGATGGG - Intergenic
908581874 1:65525424-65525446 AGACCCGGCGCTGGGGAGGGAGG - Intronic
909311192 1:74151586-74151608 AAATCCGGGGTGGGGGGGATGGG + Intronic
909475897 1:76080504-76080526 AGATCTGGGGTTGGGGGGATGGG + Intronic
909520539 1:76563238-76563260 AGACCCGGGGAAGGGGAGAAAGG + Intronic
910284390 1:85537522-85537544 AGACACTGGGGAGGGGAGATTGG + Intronic
911499362 1:98666337-98666359 AGACCTGGAGCTGTGGAGATGGG + Intronic
913062270 1:115219502-115219524 GGACCCCGAGATGGGGAGATAGG + Intergenic
913962946 1:143353665-143353687 AGTCCCGGGGTTGCGGGGCTGGG - Intergenic
914057301 1:144179250-144179272 AGTCCCGGGGTTGCGGGGCTGGG - Intergenic
914121845 1:144787116-144787138 AGTCCCGGGGTTGCGGGGCTGGG + Intergenic
914205629 1:145525193-145525215 AGACACTGGGGAGGGGAGATTGG - Intergenic
914435300 1:147654168-147654190 AGTCCTGGGGTTGGGGAGCCTGG - Intronic
915314145 1:155018465-155018487 ACACCCGAGGTGGGGGAGTTGGG - Exonic
915486145 1:156222130-156222152 TGACTTGGGGTTGGTGAGATGGG - Intronic
915794803 1:158717936-158717958 ATACATGGGGTTGTGGAGATGGG + Exonic
916179310 1:162070098-162070120 AGACCCCGGGGAGGGGAGACTGG - Exonic
917311245 1:173680975-173680997 GGAGGCGGGGTGGGGGAGATAGG + Intergenic
917503844 1:175610598-175610620 AGAACCAGGTGTGGGGAGATGGG - Intronic
919770909 1:201157970-201157992 AGGCCCTTGGTTGGGGAGAGTGG + Intronic
919830906 1:201539444-201539466 AGTCTCGGGGTAGGGGAGGTTGG + Intergenic
920390777 1:205599291-205599313 AGAGCCGGGGTCGGGGAGCGGGG + Intronic
920956160 1:210621925-210621947 AGAGCCGTGGGTGGGGAGATGGG + Intronic
923506385 1:234609582-234609604 AGACGCGGGGTTGGGGGGGGAGG - Intergenic
924608018 1:245551831-245551853 TAACCTGGGGTTGGGGAGGTTGG - Intronic
1063980099 10:11445823-11445845 ATTCACTGGGTTGGGGAGATGGG - Intergenic
1065541626 10:26775495-26775517 AGACACAGGGTTGGGGGGCTTGG - Intronic
1067267332 10:44757305-44757327 TGACGGGGGGTGGGGGAGATGGG - Intergenic
1069950923 10:72017529-72017551 AGACCGGGGGATGGGCAGGTGGG - Intergenic
1072845465 10:98825599-98825621 AGCCCCGGGGTTGGGGGGGCGGG + Intronic
1073671349 10:105593710-105593732 AAACCCTGGGTTGGGGGGGTTGG - Intergenic
1074134429 10:110614529-110614551 TCACCCCGGGGTGGGGAGATCGG - Intergenic
1075849178 10:125573665-125573687 TGAACCGAGGTTGGGGAGAGAGG - Intergenic
1077317601 11:1926272-1926294 AGAGCAGGGTTTGGGGACATGGG + Intronic
1077899372 11:6477043-6477065 AGCCCCAGGGTGTGGGAGATTGG - Exonic
1078339939 11:10491369-10491391 GGATGAGGGGTTGGGGAGATGGG + Intronic
1081301583 11:41459019-41459041 AGACTGGGGGCTGGGGAGGTGGG - Intronic
1081723371 11:45306428-45306450 GGTCCTGGGGTTGGGGTGATGGG - Intergenic
1083158760 11:60841954-60841976 GGGACCGGGGTTGGGGAGAGTGG - Intergenic
1083647082 11:64178263-64178285 AAACCCTGGGGAGGGGAGATGGG - Intergenic
1083949690 11:65947198-65947220 TGGCCAGGGGTTGGGGAGCTTGG - Exonic
1084872566 11:72108128-72108150 AAAATCTGGGTTGGGGAGATGGG - Intronic
1085166438 11:74404648-74404670 AGGCCTGGGAGTGGGGAGATAGG - Intergenic
1085245350 11:75096765-75096787 AGAGACTGGGATGGGGAGATAGG - Intergenic
1085909420 11:80803762-80803784 ATACCAGGGGATGGGGAGCTAGG + Intergenic
1086853020 11:91833514-91833536 AGACCTGGGGTTTGGAAGAAGGG + Intergenic
1087268288 11:96084467-96084489 AGACTGGGGGATGTGGAGATGGG + Intronic
1089314395 11:117581454-117581476 GGAGCTGGGGTTGGGGAGAGGGG - Intronic
1089406484 11:118201870-118201892 ACAACTGAGGTTGGGGAGATGGG + Intronic
1089655572 11:119944470-119944492 AGACCTGGGGGTTGGGAGAATGG + Intergenic
1090351634 11:126111808-126111830 AGACCTGGGGGTGGAGAGAGGGG + Intergenic
1091795805 12:3296943-3296965 GGCCCCAGGGTTGGGGAGAGGGG + Intergenic
1091890458 12:4049838-4049860 AGACCTGGGGGTGGGGTGCTGGG - Intergenic
1093130591 12:15387356-15387378 AAGCCCGGGGTTGGGGAGGGGGG + Intronic
1094388668 12:29923749-29923771 TGGCCAGGGGTTGGGGAGAGTGG + Intergenic
1095618841 12:44224889-44224911 AGACGCGGCTTTGGGGAGGTTGG - Intronic
1096613136 12:52816113-52816135 AGACCCGAGGTAGGGGAGGGAGG - Intergenic
1097784273 12:63741934-63741956 AGAGTAGGGGATGGGGAGATAGG - Intergenic
1097917882 12:65039448-65039470 AAACCCGGGGTGGGGGGGGTTGG + Intergenic
1098342797 12:69469717-69469739 AGAGCTGGGGTTGGGGGGTTGGG - Intergenic
1100877390 12:98976219-98976241 AGCCTGGGGGATGGGGAGATAGG + Intronic
1101909402 12:108850475-108850497 GGAGCTGGGGGTGGGGAGATGGG + Intronic
1102698258 12:114816830-114816852 AGACCCGTGGATGGGGAGTCAGG + Intergenic
1103192491 12:119013930-119013952 ATACCCTGGGTTGGGAAGAAGGG - Intronic
1103421005 12:120782476-120782498 ATACCTGGGGCTGGGGAGGTGGG + Intronic
1103954645 12:124569215-124569237 AGACCCTTGGTGGGGGAGGTGGG - Intergenic
1106103646 13:26715498-26715520 TTACCCGGGGTTGAGGAGATGGG - Intergenic
1109517174 13:63458630-63458652 AGACACTGGGGTGGGGAGTTGGG + Intergenic
1109715803 13:66220385-66220407 GGACCTTGGGTTGGGGAGAGAGG - Intergenic
1109985560 13:69978962-69978984 AGACCCTGGTTTGGGGGGCTGGG + Intronic
1110891601 13:80704567-80704589 AGAGCCGGGGGTGGGGAGACCGG - Intergenic
1117979701 14:61330175-61330197 AGCCCCTGGTTTGGGGAGGTGGG + Intronic
1119483412 14:74973761-74973783 AGTCCCGGGGCTGTGGGGATTGG - Intergenic
1121341327 14:93106832-93106854 ACCCCAGGGGTGGGGGAGATGGG - Intronic
1122228961 14:100295551-100295573 AACTCTGGGGTTGGGGAGATGGG + Intronic
1122314560 14:100818072-100818094 ACACCCGGGGGTGGGGGGGTGGG + Intergenic
1122411718 14:101529086-101529108 GGACCCGGGGGTGGGGAGCATGG + Intergenic
1122538445 14:102482572-102482594 AGACCCGGGATCCGGGAGAAAGG - Intronic
1122787036 14:104168610-104168632 AGACCCAGAGTCAGGGAGATCGG - Intronic
1122961669 14:105096679-105096701 AGAGCCGGGGCTGGGGACAGAGG - Intergenic
1125605756 15:40938835-40938857 AGGCTCGAGGTTGTGGAGATGGG - Exonic
1125664314 15:41417638-41417660 AGATCCGGGCTGGGAGAGATAGG + Intronic
1126739095 15:51759950-51759972 AGAGCAGGGGAGGGGGAGATTGG - Intronic
1128108037 15:65058692-65058714 AGACCGGGGAGTGGGGAGGTGGG - Intronic
1128478127 15:68014603-68014625 AGATAGGGGGTTGGGGAGAAGGG + Intergenic
1128789554 15:70423134-70423156 AGAGCTGGGTTTGGGGAGATGGG - Intergenic
1129338927 15:74872540-74872562 AGAGCCCGGGTTAGGGAGAGAGG - Intronic
1129361894 15:75029567-75029589 AGCCCTGGGGGTGGGGTGATGGG - Intronic
1129711586 15:77823020-77823042 AGACGTGGAGGTGGGGAGATTGG - Intergenic
1132244115 15:100281108-100281130 AGACGCTGGGTTGGGGATACGGG - Intronic
1132746444 16:1438278-1438300 AGACCCTGGGATCGGAAGATGGG + Intronic
1132793532 16:1706815-1706837 AGTCCCGGGGCGGGGGATATGGG - Intronic
1133802161 16:9092446-9092468 AGGCCCGGGGTTGGGGGGACAGG + Intronic
1134629287 16:15745338-15745360 AGAACCTGAGTTGGGGAGATTGG - Intronic
1134849373 16:17468548-17468570 AGATCTGCGGTTGGGGAGGTAGG - Intronic
1136145705 16:28315220-28315242 AAGACCGGGGTTGGGGGGATGGG + Intronic
1136287886 16:29254800-29254822 AGACGGGGAGATGGGGAGATGGG - Intergenic
1136368762 16:29822617-29822639 AGCCCTGGGGTTGGGGACAAAGG + Intronic
1137290095 16:47046650-47046672 ACACCTGGGTATGGGGAGATGGG + Intergenic
1137493216 16:48950257-48950279 AGACCCAGGCTTGGGTAGGTGGG - Intergenic
1137665526 16:50246806-50246828 CGACCCCGGGTAGGGGAGAGAGG + Intronic
1138494456 16:57399194-57399216 AGAACCAGGGGTGGGGAGAAGGG - Intergenic
1138627741 16:58265989-58266011 AGACGTGGGGCCGGGGAGATGGG - Intronic
1139422543 16:66857417-66857439 TGGCCTGGGGTTGGGGAGAGAGG + Intronic
1140865935 16:79062165-79062187 AGACTCAAGGTTGGGGAGACTGG + Intronic
1141602346 16:85134415-85134437 TGACCCGGCCATGGGGAGATGGG - Intergenic
1141806375 16:86344475-86344497 AGACACGGGGAAGGGGAGAGAGG - Intergenic
1141916372 16:87099992-87100014 AGAATGGGGGTTGGGGAGGTGGG - Intronic
1142093545 16:88227519-88227541 AGACGGGGAGATGGGGAGATGGG - Intergenic
1143614185 17:8039657-8039679 GGACTGGGGGTTGGGGAGAAGGG + Intronic
1144068215 17:11642752-11642774 AGACCCGGGGTTGGGGCCTGTGG + Intronic
1144532037 17:16048914-16048936 GGAACCTGGGGTGGGGAGATGGG + Exonic
1144932007 17:18867095-18867117 AGACATGGGGTTGGGGTGAGGGG + Intronic
1146296732 17:31655972-31655994 AGAGGCGGGGTGGGGAAGATGGG - Intergenic
1146464688 17:33077017-33077039 AGCCTCTGGGCTGGGGAGATGGG - Intronic
1146467779 17:33100261-33100283 AGACCTGGGGTTGGAAAGATAGG - Intronic
1146517272 17:33498975-33498997 AGACGAGGAGTTGGGGTGATGGG + Intronic
1147313596 17:39608332-39608354 AGACCCCGGGTTGGGGAGAAAGG + Intronic
1150248324 17:63692167-63692189 TGACCCGGGGGTGGGGAGGATGG + Intronic
1150443618 17:65211341-65211363 GGACAAGGGGATGGGGAGATGGG - Intronic
1151353062 17:73542943-73542965 AGACTCGGATCTGGGGAGATTGG + Intronic
1151768087 17:76142270-76142292 AGAGCCGGGGTCGGGGAGGCTGG + Intergenic
1151964626 17:77425095-77425117 AGCCCCGGGGGTGGGGGGACTGG - Intronic
1151964656 17:77425166-77425188 TGACCCGGGCCTGGGAAGATGGG + Intronic
1152286923 17:79418044-79418066 ATGCCAGGGGCTGGGGAGATAGG + Intronic
1152344503 17:79742981-79743003 AGACCCGGGGTGGGGGCTAGGGG - Intergenic
1152649595 17:81486199-81486221 AGGCCAGGGGCTGGGGAGAGAGG - Intergenic
1156227715 18:35125524-35125546 AGAGCAGGGGTTGGGGAATTAGG + Intronic
1158060466 18:53334580-53334602 AGGCTGGGGGTTGGGGAGGTTGG - Intronic
1158624241 18:59057769-59057791 AGGCCCCGGGTTGGGGAGGGTGG - Intergenic
1159010749 18:63057134-63057156 AGTCCCGGGGGTGGGGAGCTGGG + Intergenic
1159877517 18:73828829-73828851 ACACAGGGAGTTGGGGAGATAGG - Intergenic
1159923451 18:74246900-74246922 ATAGCGGGGGATGGGGAGATAGG - Intergenic
1161010753 19:1958469-1958491 GGACGGGGGGATGGGGAGATGGG - Intronic
1161053455 19:2177723-2177745 AGAGCCGGGGCTGGGCAGAGCGG - Intronic
1161596408 19:5153192-5153214 AGGGCCGGGGTCGGGGAGGTTGG + Exonic
1162823890 19:13239182-13239204 GGACCCGGGGCTGGGGAGGGCGG - Intronic
1163085785 19:14979238-14979260 AGGCCACGGGTTGGGGAGGTGGG + Intronic
1163575689 19:18109830-18109852 GGATGCGGGGTTGGGGAGTTGGG + Intronic
1164378201 19:27708299-27708321 AGTCCCGGGGCTGTGGAGATCGG + Intergenic
1166290545 19:41860512-41860534 AGTCCCGGGGCTGGGGAGTGGGG + Intronic
1167131767 19:47591389-47591411 AGACCTGGGGGACGGGAGATAGG + Intergenic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1167565366 19:50252761-50252783 AGAGCCGGGGTGGGGGAAGTGGG - Intronic
1168080770 19:54008559-54008581 AGAGTTGGGGTTGGGGAGAGAGG - Intronic
1168602045 19:57726134-57726156 AGAGACGGGGGTGGGGAGGTGGG - Intronic
1202696784 1_KI270712v1_random:131923-131945 AGTCCCGGGGTTGCGGGGCTGGG - Intergenic
925957686 2:8984224-8984246 AGGCCAGGGGTTGGGGTGAGGGG + Intronic
927544254 2:23939449-23939471 AGACCCGGGTGTGGGGAAGTGGG + Intronic
929788373 2:45007626-45007648 ACACCTGGGGTTGGTGATATGGG - Intronic
931670459 2:64642710-64642732 AGACCCTGGGTTGGGGGGGCAGG + Intronic
932615377 2:73228118-73228140 AGACCCTGGGTAGGGGAGGCTGG + Exonic
934156264 2:89203756-89203778 AGATCAGTGGTTGAGGAGATTGG + Intergenic
934211050 2:89979007-89979029 AGATCAGTGGTTGAGGAGATTGG - Intergenic
934277937 2:91588937-91588959 AGTCCCGGGGTTGCGGGGCTGGG - Intergenic
935111223 2:100096081-100096103 AGGGCTGGGGTTGGGGGGATGGG - Intronic
935653072 2:105398841-105398863 AGAGCCGGAGTTGGGGAGACTGG - Intronic
936011159 2:108926296-108926318 AGAACAGGGGTTGGGGGGCTAGG - Intronic
936123747 2:109769083-109769105 AGGGCTGGGGTTGGGGGGATAGG + Intergenic
936220939 2:110602383-110602405 AGGGCTGGGGTTGGGGGGATAGG - Intergenic
936233918 2:110726706-110726728 ACACCTGGGCTTGTGGAGATGGG + Intergenic
937003459 2:118489647-118489669 AGAGGCTGGGGTGGGGAGATCGG + Intergenic
938660892 2:133486042-133486064 AGACAGGGACTTGGGGAGATGGG - Intronic
939119440 2:138099221-138099243 AGAGCTGGGGGTGGGGAGAAGGG - Intergenic
939419748 2:141951338-141951360 GGACTCGGAGTTGGGGAGATTGG - Intronic
943566378 2:189521808-189521830 AGACCATGGACTGGGGAGATAGG - Intergenic
944254966 2:197616239-197616261 ATACATGGGGTTGGGGAGCTGGG + Intronic
945100223 2:206256628-206256650 AGGCCAGGGGTTGGGGGGTTGGG + Intergenic
946185815 2:217979800-217979822 AGAACTGGGGAGGGGGAGATAGG + Intronic
946373284 2:219293739-219293761 AGAGCTGGGGGTGGGGACATGGG - Intronic
946997081 2:225405711-225405733 AGACCTAGGGTTTGAGAGATGGG + Intronic
947444124 2:230150385-230150407 AGAGACGGGGTTGGGGGGAGGGG + Intergenic
948331689 2:237172320-237172342 AGCCCTGGGGATGGGGAGAGGGG - Intergenic
1170911176 20:20570891-20570913 AGGCCCTAGGTTTGGGAGATAGG - Intronic
1172321361 20:33997483-33997505 AGTCCAGGGTTTGGGGATATTGG + Intronic
1173676240 20:44838230-44838252 AGACTTGGGGATGGAGAGATTGG - Intergenic
1175221325 20:57418406-57418428 AGAGCTGGGGGTGGGGAGGTGGG - Intergenic
1178809699 21:35870248-35870270 AGGTCAGGGGTTGGGGAGAGTGG - Intronic
1179427037 21:41289703-41289725 CGGCCCGGGGTTGGGGAAACAGG + Intergenic
1180256796 21:46635385-46635407 AGCCGCGGGGTTGGGGGGCTCGG - Intronic
1180734574 22:18006383-18006405 TGGCCCTGGGTTGGGGAGATGGG + Intronic
1185088818 22:48754881-48754903 GGACCCTGGGGTGGGGACATGGG - Intronic
949977038 3:9470414-9470436 AGACATGGGGTAGGGGAGAAAGG - Intronic
950468283 3:13168676-13168698 AGAGCTGGTGTTGGGGAGCTTGG - Intergenic
951563394 3:23989507-23989529 AGGCACAGGGTTGGGGAGAGGGG - Intergenic
952768654 3:36977152-36977174 AGACCCTGGGTAGGGGAGGCTGG - Intergenic
952897679 3:38089004-38089026 AGACCAGGAGTCGGGGAGAGTGG - Intronic
953866691 3:46589643-46589665 AGAGACGGGGTTGGTGAGATGGG - Intronic
954535753 3:51358182-51358204 GGGGCCGGGGTTGGGGAGAGAGG + Intronic
954710828 3:52504364-52504386 AGACCTGGTGTGGGGGAGTTGGG - Intronic
956761541 3:72448276-72448298 GGGCCCGGGGGTGGGGGGATTGG + Intergenic
957041076 3:75336028-75336050 AGACCCAGGTTAGGGGAGGTAGG + Intergenic
957902417 3:86512059-86512081 ACACCAGGGGTGGGGGAGGTAGG + Intergenic
959933122 3:112003778-112003800 AGACACTGAGTAGGGGAGATGGG - Intronic
959965235 3:112346646-112346668 AGACACTGGGTTGGGGAAGTAGG - Intronic
961045881 3:123707683-123707705 AGACCCAGGTTAGGGGAGCTAGG + Intronic
961131495 3:124471653-124471675 AGACCTGGGGGTAGGCAGATGGG + Intronic
961825429 3:129596725-129596747 AGACCAGGGGCTGGGGAGGAGGG - Intronic
962318363 3:134372706-134372728 AGACCTGGGGCAGGGGAGAGGGG + Intronic
962835543 3:139185526-139185548 AGGCAGGGGGTGGGGGAGATGGG + Intronic
966919422 3:184602244-184602266 ATACCGGGGGTGGGGGAGCTGGG - Intronic
966941143 3:184748093-184748115 AAACCCGGGGGTGGGGAAAGGGG + Intergenic
968807897 4:2787217-2787239 TGACCCTGGGCTGGGGTGATAGG + Intergenic
969480856 4:7446135-7446157 AGACTGGGGGTTGGAGGGATGGG + Intronic
974494554 4:62609671-62609693 GGACCCGGGGGTGGGGACAATGG + Intergenic
975480229 4:74870586-74870608 AGATCCGGGGTTGGAGTCATTGG - Intergenic
975811801 4:78177457-78177479 AGACAAGTGGTTGGGGACATTGG + Intronic
977645108 4:99403105-99403127 AGAAATGGGGTTGGGGAGGTTGG - Intergenic
977662403 4:99605848-99605870 ATACATGGGGTTGGGGAGAATGG - Intronic
981705270 4:147652689-147652711 AGACACGGGGTAGGGTAGAATGG - Intronic
982759678 4:159266181-159266203 AGAAAAGGGGTTGGGGGGATGGG + Intronic
983554299 4:169046235-169046257 GGACCAGGGGCTGGGGAGTTGGG + Intergenic
985802849 5:2017039-2017061 AGAGACGGGGTGGGGGTGATTGG + Intergenic
989318428 5:40107898-40107920 AGTCCTGGGGCTGTGGAGATCGG - Intergenic
992562808 5:77968990-77969012 AGACCAGGGGTTGGGGCGGGGGG + Intergenic
992643904 5:78794568-78794590 AGAGGTGGGGTTGGGGAGAAAGG + Intronic
994083249 5:95731281-95731303 AGAAGGGGGGTCGGGGAGATCGG - Exonic
995481316 5:112595907-112595929 AGGGCAGGGGTTGGGGAGTTGGG - Intergenic
996566185 5:124881607-124881629 AAACCTGGGGCTGGGCAGATTGG - Intergenic
998352825 5:141512333-141512355 AGTCCCTGGGTTGGGGAGGCAGG + Exonic
998848674 5:146334535-146334557 GGACCCTGGGCTTGGGAGATGGG + Intronic
999208416 5:149867222-149867244 AGATGCGCAGTTGGGGAGATCGG - Intronic
999696168 5:154190418-154190440 AGTCCCGGAGTTGGCGAGTTGGG - Intronic
1000083315 5:157867656-157867678 TGAGGTGGGGTTGGGGAGATGGG + Intergenic
1001397772 5:171429111-171429133 AAGCCCGGGGTTGAGGAGGTGGG + Intronic
1002639163 5:180622515-180622537 AGCCCCAGGGTTGGGGACAGAGG + Intronic
1003442031 6:6151788-6151810 AAACCTTGGGTTGGGGAGACCGG - Intronic
1003809478 6:9763971-9763993 AAACCAGGGGTTGAGGATATGGG - Intronic
1003908923 6:10726068-10726090 AGACCCTGGTTTGGTGGGATGGG + Intronic
1004160489 6:13208628-13208650 AGACATGGGGTTGGGGGGGTGGG - Intronic
1004290590 6:14363531-14363553 AGCCCCCGGGTTGGGGAGGTGGG + Intergenic
1005601431 6:27430337-27430359 AGACCCGGGGGTGGGTGGGTGGG - Intergenic
1006405276 6:33841457-33841479 GGACCCCGGGCTGGGGAGAGGGG + Intergenic
1015044164 6:128759409-128759431 TGATCCAGGCTTGGGGAGATGGG - Intergenic
1015117356 6:129664244-129664266 ATAGCAGGGGATGGGGAGATAGG + Intronic
1016547454 6:145240385-145240407 AAAACCGGGGTTGGGGGGTTGGG - Intergenic
1018627481 6:165793473-165793495 AGACCCGGGGCTGGGGGGCGTGG + Intronic
1018628583 6:165803918-165803940 TGAGCTGGGGTTGGGGAGATGGG - Intronic
1018698649 6:166410167-166410189 TGACCCGGGGGTGGGGGGTTGGG + Intronic
1019003364 6:168775243-168775265 AGACCAGGGGTTGCTGAGAGAGG + Intergenic
1019100212 6:169623996-169624018 AGACACAGGATTGGGGACATGGG + Intronic
1019928822 7:4210166-4210188 AGACCCGGGGTTGGGGAGATGGG + Intronic
1020472553 7:8555641-8555663 AGAAATGAGGTTGGGGAGATTGG - Intronic
1022114473 7:27250090-27250112 AGGGCCGGGGTTGGGGATGTGGG - Intergenic
1022129484 7:27391333-27391355 AGACCTAGGGTTGGGGAAACAGG + Intergenic
1022562688 7:31366087-31366109 AGAACCAGGGTTGGGGAAAAGGG + Intergenic
1024209717 7:47192807-47192829 GGACCCAGGGTTAGGGAGACTGG - Intergenic
1025994625 7:66520159-66520181 AGACACGGGGTTGTAGAGATGGG + Intergenic
1026283113 7:68939393-68939415 AGACTCAGGGTTGGTGTGATAGG + Intergenic
1026898322 7:74023248-74023270 TGAGCCGGGGGTGGGGAGGTGGG - Intergenic
1027705788 7:81531824-81531846 AGAACCAGGGTTGAGGGGATGGG + Intergenic
1029380559 7:100211707-100211729 ACACCCGGGGTGGGGGAAGTGGG - Intronic
1031026453 7:116685316-116685338 AGTCCCGGGGTTAAGGAGAAAGG - Intronic
1031264432 7:119566315-119566337 ACAACCTGGGTTGGGGACATTGG + Intergenic
1033042041 7:137927692-137927714 AGATCTGGGGTGGGGGACATGGG + Intronic
1033218471 7:139511524-139511546 GGAGCCGGGGAAGGGGAGATGGG + Intergenic
1036227014 8:6967825-6967847 AGAGCAGTGGATGGGGAGATTGG + Intergenic
1036229455 8:6986994-6987016 AGAGCAGTGGATGGGGAGATGGG + Intergenic
1036231906 8:7006097-7006119 AGAGCAGTGGATGGGGAGATGGG + Intronic
1036552495 8:9827452-9827474 AGACCTGGGGTTGAGGTGGTGGG + Intergenic
1036678039 8:10851165-10851187 GGCCCCGGGGTTGGGGGGAGGGG + Intergenic
1036818144 8:11917061-11917083 ATACCCGGGGGTGGGGAGGGTGG + Intergenic
1037962554 8:23109123-23109145 AAACTGGGGGTTAGGGAGATGGG + Intronic
1038410708 8:27356881-27356903 AAACTAGGGGTTGTGGAGATGGG + Intronic
1040392843 8:46964189-46964211 AGACTTGGGGTTGGGGTGGTGGG + Intergenic
1042555863 8:70033319-70033341 AGACCCGGGGTCGGGGATGGGGG - Intergenic
1042695627 8:71551702-71551724 ATACCAGGGGTTTGGGAGGTAGG + Intronic
1043144652 8:76637821-76637843 TGTCGCGGGGGTGGGGAGATGGG + Intergenic
1045060087 8:98403541-98403563 TGCCCTGGGGTTAGGGAGATGGG - Intronic
1045072347 8:98521479-98521501 AGACTCAGGGTAGGGGAAATCGG - Intronic
1045185373 8:99831906-99831928 AGAGGCTGGGTTGGGGACATGGG - Intronic
1049334691 8:142077046-142077068 AGCCCCTGGGTTGAGGAGGTCGG + Intergenic
1049575309 8:143387053-143387075 TGACCTCGGGTTGGGGAGAGTGG - Intergenic
1050182597 9:2936201-2936223 AGACCTGGGGTTGGGATAATAGG + Intergenic
1051387538 9:16525060-16525082 AGACCCGGAGTGGGGGAGGGGGG + Intronic
1052362426 9:27575218-27575240 AGACCCTTGGTTGGGGGGCTTGG + Intergenic
1055022169 9:71682087-71682109 AGACTCGGGGATGGGAAGAGAGG - Intergenic
1057293463 9:93821552-93821574 AGGCCCTGGGGTGGGAAGATAGG - Intergenic
1057527603 9:95816551-95816573 AGTTCCGGGTTTGGGGAGGTAGG + Intergenic
1058053577 9:100428571-100428593 AGACCCGGGCTAGGGGACAAAGG + Intronic
1059032330 9:110712178-110712200 AGTGCCTGGGTTGGGGAGAAGGG + Intronic
1061725307 9:132579294-132579316 GGACCTGGGGCTGGGGAGAGGGG + Intergenic
1062600207 9:137316015-137316037 AGCCCCGGGGAGGGGGAGAAGGG - Intronic
1187346905 X:18473837-18473859 AGACCTGGGGGTGGGGAGAGGGG + Intronic
1187952580 X:24485480-24485502 AGAGCCCGGGGTGGGGGGATAGG + Intronic
1188003428 X:25002350-25002372 GGACCCGGGGTTGGAGAGGAGGG + Intergenic
1189681131 X:43517822-43517844 AGATCCAGGGTTGGGGAGAGAGG + Intergenic
1189905719 X:45757179-45757201 TTACCTGGGGTAGGGGAGATGGG - Intergenic
1190031602 X:46978449-46978471 AGAACCAGGGTTGGGGAAAATGG + Intronic
1190297182 X:49034545-49034567 AGCCCCGGGGTTTGGGAAAGGGG - Intronic
1190844653 X:54181302-54181324 AGAACCTTGGTTGGGGAAATAGG + Intronic
1192264770 X:69530690-69530712 CCACCCGGCTTTGGGGAGATGGG + Exonic
1193756186 X:85411394-85411416 AGTCCGGGGGTTGAGGAAATAGG - Intergenic
1195691428 X:107628838-107628860 AGACTGGGGGTTGGGGGGAGAGG + Intronic
1196734489 X:118972664-118972686 TGAACCGGGGTTGAGGGGATGGG - Intergenic
1197126191 X:122948956-122948978 AGACCAGGTGTTGGGGATTTGGG + Intergenic
1197600029 X:128517888-128517910 AGACCCGGGGTGGGGTTGGTTGG - Intergenic
1198809964 X:140525087-140525109 TGACCCGGGGGTGGGGGGATAGG - Intergenic
1199474609 X:148231599-148231621 AGAACAGGGGATGGGGAGAAGGG - Intergenic