ID: 1019930342

View in Genome Browser
Species Human (GRCh38)
Location 7:4218661-4218683
Sequence CTGCTGTCAGCCCTAAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 139}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019930342_1019930350 -4 Left 1019930342 7:4218661-4218683 CCATTTCTTAGGGCTGACAGCAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1019930350 7:4218680-4218702 GCAGGAGGGCAGGGCTGGGCAGG 0: 1
1: 4
2: 35
3: 314
4: 1935
1019930342_1019930351 -1 Left 1019930342 7:4218661-4218683 CCATTTCTTAGGGCTGACAGCAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1019930351 7:4218683-4218705 GGAGGGCAGGGCTGGGCAGGTGG 0: 1
1: 3
2: 38
3: 472
4: 2510
1019930342_1019930352 6 Left 1019930342 7:4218661-4218683 CCATTTCTTAGGGCTGACAGCAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1019930352 7:4218690-4218712 AGGGCTGGGCAGGTGGACTCAGG No data
1019930342_1019930348 -9 Left 1019930342 7:4218661-4218683 CCATTTCTTAGGGCTGACAGCAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1019930348 7:4218675-4218697 TGACAGCAGGAGGGCAGGGCTGG 0: 1
1: 0
2: 4
3: 81
4: 802
1019930342_1019930357 30 Left 1019930342 7:4218661-4218683 CCATTTCTTAGGGCTGACAGCAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1019930357 7:4218714-4218736 CGGTGGGTGCCACTCACCAAGGG No data
1019930342_1019930355 14 Left 1019930342 7:4218661-4218683 CCATTTCTTAGGGCTGACAGCAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1019930355 7:4218698-4218720 GCAGGTGGACTCAGGACGGTGGG No data
1019930342_1019930349 -8 Left 1019930342 7:4218661-4218683 CCATTTCTTAGGGCTGACAGCAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1019930349 7:4218676-4218698 GACAGCAGGAGGGCAGGGCTGGG No data
1019930342_1019930354 13 Left 1019930342 7:4218661-4218683 CCATTTCTTAGGGCTGACAGCAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1019930354 7:4218697-4218719 GGCAGGTGGACTCAGGACGGTGG 0: 1
1: 0
2: 5
3: 23
4: 238
1019930342_1019930353 10 Left 1019930342 7:4218661-4218683 CCATTTCTTAGGGCTGACAGCAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1019930353 7:4218694-4218716 CTGGGCAGGTGGACTCAGGACGG No data
1019930342_1019930356 29 Left 1019930342 7:4218661-4218683 CCATTTCTTAGGGCTGACAGCAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1019930356 7:4218713-4218735 ACGGTGGGTGCCACTCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019930342 Original CRISPR CTGCTGTCAGCCCTAAGAAA TGG (reversed) Intronic
901142268 1:7042742-7042764 CTGCTGCCAGCCCTACTGAAGGG - Intronic
903949954 1:26990921-26990943 GTGATATCATCCCTAAGAAAGGG - Intergenic
908069459 1:60442313-60442335 CTGCTGTCATCCCTAAAATTGGG - Intergenic
909358568 1:74735788-74735810 CTGCTGTCTGCCCTTGGAACCGG - Intronic
909779568 1:79525937-79525959 CTGCTGTCATCCTTAAGGGAAGG + Intergenic
917829451 1:178864358-178864380 TTGCCGTCAGCCTCAAGAAAAGG - Intronic
919604555 1:199665560-199665582 CTGGTGTCAGGCCTGAGGAATGG + Intergenic
920808347 1:209256480-209256502 CTGCTGTCTGCTCAAAGAAGGGG + Intergenic
921477030 1:215623632-215623654 CTTCTGTCTGCCCTAAGCTATGG + Exonic
922938277 1:229437553-229437575 CTCCTGGCAGCCCAAAGAAAGGG + Intergenic
1062874946 10:935550-935572 CTACTGTCATCCCAAAGAAATGG + Intergenic
1063030248 10:2227296-2227318 GTGCTGTCAGCCCTTGTAAAAGG - Intergenic
1064677508 10:17776263-17776285 GTAATGTTAGCCCTAAGAAAAGG - Intronic
1067286659 10:44912145-44912167 CTGCAGTCAGACCTCAGACAGGG - Intronic
1067395072 10:45907891-45907913 CTACTATCAACACTAAGAAAGGG - Intergenic
1067863391 10:49877024-49877046 CTACTATCAACACTAAGAAAGGG - Intronic
1069822072 10:71234423-71234445 CTGCTCTCTGCTCTATGAAAAGG + Intronic
1073580454 10:104660749-104660771 CTGATGCCAGCCCTAAAAATTGG - Intronic
1073923829 10:108490221-108490243 CTGCTCTCATCCCCAAGGAAAGG - Intergenic
1074147378 10:110728802-110728824 CTGCTGTCAGTCCTGAGACCTGG - Intronic
1084711647 11:70847452-70847474 CTGCTGTCAGCGTTAAAAATAGG + Intronic
1089229892 11:116964448-116964470 CAGCTGTCAAGCCTAAGGAATGG + Intronic
1089614377 11:119686985-119687007 CTGCAGTCAGACCTGAGAAATGG - Intronic
1089833898 11:121353149-121353171 CAGCTGTCAGTCCTGAGGAAGGG + Intergenic
1091188588 11:133669867-133669889 CTGCTGTCTGCCCACAGAGAGGG + Intergenic
1092576730 12:9792289-9792311 ATGCTGCTAGCCCTAAGCAAAGG + Intergenic
1093280248 12:17185525-17185547 CAGCTGCCAGCCCACAGAAAAGG + Intergenic
1095271644 12:40225414-40225436 CTGCTTTCTGCCCTAAGGAAAGG - Intronic
1096491923 12:52017445-52017467 CTGCTGTCAGCCTGGAGAAAGGG - Intergenic
1097453021 12:59758919-59758941 CAGCTGACAGCCCTTAAAAATGG - Intronic
1100565033 12:95787457-95787479 CTCCACTCAGTCCTAAGAAAGGG + Exonic
1104490279 12:129188177-129188199 CTTGTGTCAGCCCTGAGACAAGG + Intronic
1105461759 13:20597005-20597027 CTGATTTCAGGCCTTAGAAAAGG + Exonic
1110339184 13:74369116-74369138 CTGCTTCCAGCTCTTAGAAATGG + Intergenic
1113420634 13:110169224-110169246 CTCCTGCCAGTCCTAAGAGATGG + Intronic
1119165186 14:72486635-72486657 CTCCTTTCATGCCTAAGAAATGG + Intronic
1120577636 14:86203438-86203460 TTTCTGTTAGCCCTGAGAAAAGG - Intergenic
1121685683 14:95833344-95833366 CTGGAGTCAGCCCAAAGACAGGG + Intergenic
1122090232 14:99333792-99333814 CAGCTGGTAGCCCGAAGAAAAGG - Intergenic
1122448534 14:101784742-101784764 CTTCTTTCTGCCCAAAGAAAGGG - Intronic
1122937619 14:104967270-104967292 CTGCTGTGAGGCCCAAGAAAGGG + Intronic
1125197409 15:37063162-37063184 CTGTTGTCAGACCTAAAATATGG - Intronic
1125362338 15:38877357-38877379 CTGCTCTCCTCCCCAAGAAAGGG - Intergenic
1128303158 15:66580050-66580072 CTGCTTTCTGTCCTATGAAATGG - Intergenic
1129377525 15:75143451-75143473 CAGCTGCCAGACTTAAGAAATGG - Intergenic
1130207514 15:81890950-81890972 CTCCTATCAGCCATCAGAAAAGG + Intergenic
1132325594 15:100967099-100967121 CTGCTGTCATCCCTCAGATGGGG - Intronic
1135895447 16:26397049-26397071 CTCCTGTCCACCCTAACAAAGGG - Intergenic
1135912845 16:26577231-26577253 CTGAAGTCAGCCCTAGGCAAGGG - Intergenic
1137345165 16:47650859-47650881 ATGCTGGCAGCCCTTAAAAAAGG + Exonic
1139715374 16:68809178-68809200 CTGCTGCCAAGCCCAAGAAATGG - Intronic
1141576962 16:84970215-84970237 CTGCTATCAGCATTGAGAAAAGG - Intergenic
1143343461 17:6232243-6232265 ATGCTGTCAGCTCTCAGCAACGG - Intergenic
1145366490 17:22270447-22270469 TTGCTGTCAGCCTTATGCAAGGG + Intergenic
1145789306 17:27615510-27615532 CTTCTCTCAGCAATAAGAAAAGG - Intronic
1149447163 17:56722432-56722454 CTTCTGCCAGCCCAAGGAAAAGG + Intergenic
1152288954 17:79428058-79428080 CTACACTCAGCCTTAAGAAATGG + Intronic
1153166761 18:2270279-2270301 CTTCTGTCATACCAAAGAAAAGG - Intergenic
1154248536 18:12722281-12722303 TAGCTGTCATCCCTAAGAGAAGG + Intronic
1156749860 18:40438974-40438996 CTGATTTCAGCCCTATGAGAGGG + Intergenic
1157017240 18:43730853-43730875 CTGCCTTCAACCCTTAGAAAAGG - Intergenic
1157930919 18:51822323-51822345 CTGCTCTGAATCCTAAGAAAAGG + Intergenic
1162351379 19:10151836-10151858 CTGCTGACACACCTAAAAAATGG + Exonic
1163740238 19:19007282-19007304 CTGCTGTCAGACCTGGGCAAGGG + Intronic
1164227498 19:23258627-23258649 CTGATCTCTGCCCTCAGAAAAGG - Intergenic
1164401672 19:27906289-27906311 CTGCTTTCAGCCCCAAGAAGAGG + Intergenic
1167089707 19:47335434-47335456 CAGCTGTAAGCCCAAAGCAATGG - Intronic
1167868586 19:52348794-52348816 CTCATGTAAGCCCTCAGAAATGG - Intronic
1167883996 19:52485483-52485505 CTGAGCTCAGCCCTCAGAAATGG - Intronic
1167920480 19:52779240-52779262 CTGAGCTCAGCCCTCAGAAATGG + Intronic
1167922308 19:52791912-52791934 CTGAGCTCAGCCCTCAGAAATGG + Intronic
927790032 2:26002622-26002644 CTGCTGACACACCTTAGAAACGG - Intergenic
929934181 2:46282334-46282356 CTGCTCTCATCCCTAAATAATGG - Intergenic
931611334 2:64104376-64104398 CAGCTGTCTGCCCTGAGAAGTGG - Intronic
933261297 2:80134526-80134548 CTTCTGTCTGCCCTCAGAAGTGG - Intronic
935857489 2:107290893-107290915 GGGCTGTTAGCCCTAAGAAGGGG + Intergenic
935904150 2:107825855-107825877 CTGCTGCCAGCCCCATGATAGGG + Intergenic
937387923 2:121453904-121453926 CTGCCCTCTGCCCTCAGAAAGGG - Intronic
939725662 2:145718455-145718477 CTGCTGTCAGCATTAAATAATGG - Intergenic
941937345 2:170994906-170994928 CTAGTGTCAGCATTAAGAAAGGG - Intronic
945762190 2:213927430-213927452 TTTCTCTCAGCCCTCAGAAATGG + Intronic
948866644 2:240778464-240778486 CTGCTGAGAGCTCTGAGAAATGG - Intronic
1170604822 20:17867894-17867916 CTGCAGGCAGCCCAAAGAACAGG + Intergenic
1172778505 20:37422097-37422119 CTGCTGTGAGCCTGAAGAAGGGG + Intergenic
1173215440 20:41077664-41077686 CTGCTGTCCACCCAGAGAAAGGG - Intronic
1174705247 20:52648510-52648532 CTGCTGCCAGCCCTTCGAACAGG + Intergenic
1176134501 20:63515777-63515799 CTGCTCTCAGTCCTGGGAAAAGG + Intergenic
1178417489 21:32415538-32415560 CAGCTGACAGCCCCAGGAAAAGG - Intronic
1182321159 22:29479381-29479403 CTGCTGCCAGCCCCAGTAAAGGG - Intergenic
1184330546 22:43824391-43824413 CTGCTGTCAACCCCAGGGAATGG + Intergenic
1184668035 22:45998702-45998724 CTGCTGCCAGCCCTGGGGAAGGG - Intergenic
1185143864 22:49118866-49118888 CTTCTGTGAGCCCCAGGAAATGG - Intergenic
951201316 3:19877768-19877790 CTGCTCTCAGAGCTAAGAATTGG + Intergenic
960038788 3:113128391-113128413 CTGCTGCCAGCCCTAACTGAGGG - Intergenic
961348362 3:126279639-126279661 CTGTTGTCAGCCAGCAGAAAAGG - Intergenic
963407245 3:144881510-144881532 GTGGTGTCAACCCTAATAAAAGG + Intergenic
963600351 3:147373034-147373056 CTGCTCCCAGACCTGAGAAAAGG + Intergenic
965966177 3:174492942-174492964 CTACAGTCAGCAGTAAGAAATGG - Intronic
968521792 4:1037524-1037546 CTGCAGGCAGCCCTGAGGAATGG + Intergenic
969143719 4:5102066-5102088 TTGCTGTCAGCCCAGAGATAAGG + Intronic
969639022 4:8385815-8385837 CTGCAGTCAGCCCTGAGACCTGG + Intronic
970344997 4:15144668-15144690 CTGCTGGGAGCCCTAAAGAAAGG + Intergenic
973550958 4:52035792-52035814 CTTCTGACAGCCCTAACAGATGG + Intronic
974973593 4:68861982-68862004 CTACTGTGAGCCCTGATAAAGGG - Intergenic
975533365 4:75423315-75423337 ATGCTGTTTGCTCTAAGAAATGG - Intergenic
975729577 4:77324507-77324529 CTGCTGACAAGACTAAGAAAAGG - Intronic
976240235 4:82947606-82947628 CTTTTGTCAGACCAAAGAAAAGG - Intronic
978872109 4:113591905-113591927 CTGTGGTGAGCCCTAAGACAAGG - Intronic
979689789 4:123547868-123547890 CTGCTTTCTGCCCAAATAAAGGG + Intergenic
981649533 4:147040096-147040118 ATGCTGTCAGCCCCAACAGATGG - Intergenic
982163375 4:152592098-152592120 CTGGTTTGAGCCCTCAGAAAAGG - Intergenic
985955240 5:3260863-3260885 GTCATGGCAGCCCTAAGAAATGG - Intergenic
991392438 5:66161117-66161139 CTCATATCAACCCTAAGAAATGG - Intronic
996137975 5:119868747-119868769 ATGCTCTCAGGCCTGAGAAAAGG - Intergenic
996879295 5:128276610-128276632 CTGCTCTCAGGCCCAAGAGATGG + Intronic
997617855 5:135264462-135264484 CTGCTGTTAGCCCTTAAAACAGG + Intronic
998442825 5:142176473-142176495 CTGCAGTCAGCACTCAGAACAGG + Intergenic
1001107102 5:168863705-168863727 CTGATCTCAGCCCAAAGAATGGG - Intronic
1004050633 6:12075083-12075105 CTGCAGTCAGCCCTGAGGAAAGG - Intronic
1004719965 6:18260618-18260640 CTGAAGTCTGTCCTAAGAAAGGG - Intronic
1007665047 6:43508991-43509013 CTTCTGTCAGCCCTAGGTATGGG + Intronic
1008155567 6:48009791-48009813 CTACTGTCATCAATAAGAAAAGG - Intronic
1009320702 6:62285681-62285703 CTGCTGTCCGCCCCAAGAACGGG + Intronic
1012941837 6:105423802-105423824 CTGCTGCCAGCCCACATAAATGG - Intergenic
1018574499 6:165245065-165245087 CTGCTGCCACCCCCAAGAAGAGG - Intergenic
1019930342 7:4218661-4218683 CTGCTGTCAGCCCTAAGAAATGG - Intronic
1020865359 7:13554174-13554196 CTGCTGTAAATCCTGAGAAAAGG - Intergenic
1026256490 7:68716528-68716550 CTGGTGTCATCCCCAAGTAAGGG + Intergenic
1038662447 8:29508917-29508939 ATGCTTTCTGCCCTAAGAAAAGG + Intergenic
1038891626 8:31732114-31732136 CTGCTGTCATCACCAAGAACTGG - Intronic
1039045324 8:33444337-33444359 CTGCTCGCAGCCCTCAGACATGG - Intronic
1040699817 8:50048381-50048403 CTGCTGCTAGCCCTGAAAAATGG + Intronic
1046729599 8:117710964-117710986 TTACTGTCAACTCTAAGAAAGGG + Intergenic
1047595323 8:126372130-126372152 CTCATGGCAGACCTAAGAAATGG - Intergenic
1048201669 8:132379720-132379742 TAGCTGTCTGCCCTGAGAAAGGG - Intronic
1049758174 8:144320072-144320094 CTGCTGTCAGCCCTCGGGAGAGG - Intronic
1049831615 8:144704655-144704677 CTGCTGCCAGCTCTACCAAAAGG + Intergenic
1050029839 9:1374317-1374339 CTGCTGCCAGCCCTAAAGAGTGG - Intergenic
1053196273 9:36121450-36121472 CAGCTGGCAGCCCAAAGCAAGGG + Intronic
1057339191 9:94183872-94183894 CTCATGTCAGCACTAAGAAGGGG - Intergenic
1060985541 9:127817069-127817091 CAGCGGGCAGCCCTGAGAAACGG - Intronic
1061175984 9:128997444-128997466 CTTCTGTCAACCCTTAGATATGG - Intronic
1061803961 9:133127983-133128005 CTGCTGTCATCCCTTGGAAATGG + Intronic
1062403472 9:136382567-136382589 CTGCTGTCAGCCTGAGGAACTGG - Intronic
1188765570 X:34087622-34087644 CTTCTGTGAACTCTAAGAAAGGG - Intergenic
1189644320 X:43110252-43110274 CTGCTTTCATTCCTAAGAAGGGG + Intergenic
1190483625 X:50902078-50902100 CTGCTCCCAGCACTTAGAAATGG - Intergenic
1193473042 X:81929818-81929840 CTTCTGACAGCTATAAGAAAAGG + Intergenic
1198932861 X:141879386-141879408 CTGCCGTCAGCCCTGGAAAAAGG + Exonic
1198936036 X:141903606-141903628 CTGCTGTCAGCCCTGGAAAAAGG + Intergenic
1198960295 X:142175433-142175455 CTGCTGTCAGCCCTGGGAAAAGG - Intergenic
1199418258 X:147612154-147612176 TTTCTGTCACCCATAAGAAAGGG + Intergenic
1201579880 Y:15500110-15500132 CTGCTTTCAGCCCTCATAGACGG - Intergenic