ID: 1019930356

View in Genome Browser
Species Human (GRCh38)
Location 7:4218713-4218735
Sequence ACGGTGGGTGCCACTCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019930342_1019930356 29 Left 1019930342 7:4218661-4218683 CCATTTCTTAGGGCTGACAGCAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1019930356 7:4218713-4218735 ACGGTGGGTGCCACTCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019930356 Original CRISPR ACGGTGGGTGCCACTCACCA AGG Intronic
No off target data available for this crispr