ID: 1019931313

View in Genome Browser
Species Human (GRCh38)
Location 7:4225172-4225194
Sequence CAGTCTCACAACTGGGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 144}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019931313_1019931322 17 Left 1019931313 7:4225172-4225194 CCCATGTCCCAGTTGTGAGACTG 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1019931322 7:4225212-4225234 ATGTTACCACTGGGGGACACTGG No data
1019931313_1019931325 24 Left 1019931313 7:4225172-4225194 CCCATGTCCCAGTTGTGAGACTG 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1019931325 7:4225219-4225241 CACTGGGGGACACTGGGTAAAGG No data
1019931313_1019931323 18 Left 1019931313 7:4225172-4225194 CCCATGTCCCAGTTGTGAGACTG 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1019931323 7:4225213-4225235 TGTTACCACTGGGGGACACTGGG 0: 1
1: 17
2: 82
3: 216
4: 564
1019931313_1019931317 -6 Left 1019931313 7:4225172-4225194 CCCATGTCCCAGTTGTGAGACTG 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1019931317 7:4225189-4225211 AGACTGCAGCACAGTTTTGCAGG No data
1019931313_1019931321 10 Left 1019931313 7:4225172-4225194 CCCATGTCCCAGTTGTGAGACTG 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1019931321 7:4225205-4225227 TTGCAGGATGTTACCACTGGGGG 0: 3
1: 15
2: 73
3: 191
4: 383
1019931313_1019931320 9 Left 1019931313 7:4225172-4225194 CCCATGTCCCAGTTGTGAGACTG 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1019931320 7:4225204-4225226 TTTGCAGGATGTTACCACTGGGG 0: 3
1: 17
2: 104
3: 241
4: 463
1019931313_1019931318 7 Left 1019931313 7:4225172-4225194 CCCATGTCCCAGTTGTGAGACTG 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1019931318 7:4225202-4225224 GTTTTGCAGGATGTTACCACTGG 0: 2
1: 23
2: 120
3: 262
4: 493
1019931313_1019931319 8 Left 1019931313 7:4225172-4225194 CCCATGTCCCAGTTGTGAGACTG 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1019931319 7:4225203-4225225 TTTTGCAGGATGTTACCACTGGG 0: 3
1: 19
2: 116
3: 278
4: 514

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019931313 Original CRISPR CAGTCTCACAACTGGGACAT GGG (reversed) Intronic
906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG + Intronic
908662624 1:66453323-66453345 AAGTATCAAAACTGGGAAATGGG + Intergenic
913329769 1:117657514-117657536 CAGTCTCCATACTGGGAGATGGG + Intergenic
919563583 1:199155906-199155928 TAGTCTTCAAACTGGGACATTGG + Intergenic
923503286 1:234584057-234584079 CAGTCTCACAATTTAAACATAGG - Intergenic
923683769 1:236140613-236140635 CAGTCTCTCCCCTGGCACATTGG - Intergenic
1065454306 10:25891197-25891219 CAGTATGACACCTGGGACAAGGG - Intergenic
1065507596 10:26444798-26444820 CAGTTTAAGAAATGGGACATAGG + Intronic
1066708116 10:38203168-38203190 CAGGTCCACAGCTGGGACATGGG - Intergenic
1067806017 10:49394494-49394516 CAGTCTCAGCACTGGGGTATTGG - Intronic
1071944129 10:90621927-90621949 CAGTCTCAAAGTTGGGAGATTGG - Intergenic
1072065077 10:91860471-91860493 CAGTGTCACATCTGGGAACTTGG - Intronic
1073229572 10:101957365-101957387 CAGTCTCTCAATTGGGACCAAGG + Intronic
1075241117 10:120779942-120779964 CAGTCTCAAAAGTGGGTTATTGG - Intergenic
1076531771 10:131149717-131149739 CAGTTTTACTACTGCGACATTGG + Intronic
1076589555 10:131573888-131573910 CAGGCTCACAGCTGGGAGGTAGG + Intergenic
1077510098 11:2954925-2954947 CAGTCTCACATATGGGAAACAGG + Intronic
1080935656 11:36860459-36860481 GAGTCTCCACACTGGGACATAGG - Intergenic
1081838473 11:46177173-46177195 CAGTCTCAGAAATGGGATTTGGG + Intergenic
1081984349 11:47290715-47290737 GAGTTCCACAACTGGGACCTCGG + Exonic
1084361071 11:68669025-68669047 TAGTCTCATAACTGTGACAAGGG - Intergenic
1091588042 12:1827252-1827274 GTGTCTCCCAACTGGGACACAGG - Intronic
1096773029 12:53948502-53948524 CAGGCTCACTACTGGTGCATTGG + Intergenic
1096957993 12:55546475-55546497 CAGGCTCACAAATGAGACTTTGG - Intergenic
1097693505 12:62755940-62755962 CAGGCCCACAACTGACACATTGG - Intronic
1099814118 12:87623123-87623145 CTGTCTTTAAACTGGGACATTGG - Intergenic
1102613885 12:114136141-114136163 AAGTCTCACAACTGAGTCAGTGG + Intergenic
1103007199 12:117430733-117430755 TTGGCTCACAACTGGGAAATTGG + Intronic
1104228362 12:126859288-126859310 CAGTGTCAGAACTGGGACACAGG - Intergenic
1106435380 13:29719213-29719235 CAGTATCACAACCAGGATATTGG + Intergenic
1108711623 13:53038681-53038703 CAGTCCCACATCTGGCACTTGGG - Intronic
1110386085 13:74912397-74912419 CAGCATCACAACTAGGATATTGG - Intergenic
1110904774 13:80872779-80872801 CAATTTCACTACTGGGACTTAGG + Intergenic
1113994404 14:16054519-16054541 CAATCTCGCAACTGGGACGCCGG + Intergenic
1114568652 14:23650325-23650347 CAGCCTCACAAGCGGAACATGGG - Intergenic
1118123354 14:62871272-62871294 CAGTGTCACAAATGCTACATAGG + Intronic
1119419560 14:74500476-74500498 CGATCCCACAACTGGGACAGAGG - Exonic
1120102181 14:80457963-80457985 AATGCTCACAACTGAGACATAGG + Intergenic
1121618294 14:95328581-95328603 GAGTCTCACAACTCTAACATGGG + Intergenic
1122660298 14:103290575-103290597 CAGTCCCACAACGTGGACCTGGG + Intergenic
1123900826 15:24875240-24875262 CAGATTCACAACTGGAACTTGGG - Intronic
1124506536 15:30281366-30281388 CAGTATCAAAAGTGGGACACTGG - Intergenic
1124737021 15:32257270-32257292 CAGTATCAAAAGTGGGACACTGG + Intergenic
1125403293 15:39327294-39327316 CAGTGACAAAACTTGGACATAGG + Intergenic
1132281465 15:100619584-100619606 CAGTTTAATAAATGGGACATAGG + Intronic
1135761855 16:25144274-25144296 GAGCCTCACAACTGGGAGAAAGG - Intronic
1138381382 16:56605192-56605214 CAGTCACACATCTGGCACTTTGG - Intergenic
1139892570 16:70263112-70263134 CAGTGTTAAAACTGGGACAATGG + Intronic
1141152034 16:81570850-81570872 CAGTCACGCACCTGGGACACAGG - Intronic
1143001219 17:3796459-3796481 CCGTCTCCCCTCTGGGACATGGG + Intronic
1144847740 17:18228807-18228829 CAGTCTCTCATCTGGGCCCTTGG - Intronic
1149622877 17:58059533-58059555 CAGTTTCACATCTGGGAGAAAGG + Intergenic
1150467093 17:65403080-65403102 GAGGCTTACAGCTGGGACATTGG - Intergenic
1151418447 17:73982040-73982062 CCGTCTCACAAGTGGGACAGCGG - Intergenic
1154044950 18:10895650-10895672 CAGTTTAACACCTGGGAAATGGG + Intronic
1157241450 18:46013837-46013859 AACTCTGACAACTGTGACATTGG + Intronic
1157940734 18:51926438-51926460 CAGTCACAGTACTGGGCCATGGG - Intergenic
1158536306 18:58311285-58311307 CAGTCCCACAAATGGTACACAGG - Intronic
1159348730 18:67242209-67242231 CAGCCTCACACCTGCTACATAGG + Intergenic
1162640432 19:12004664-12004686 TAGTCTCAGAACTAGGAAATTGG + Intergenic
1164691347 19:30213045-30213067 CAATCTCACACCTGGGAGACCGG - Intergenic
1165084834 19:33337078-33337100 TTGTCTCCAAACTGGGACATGGG + Intergenic
1165636167 19:37341999-37342021 CAGTCCCAAATCTGGTACATGGG - Intronic
1167041215 19:47023479-47023501 TAGTCCCAAAACTGGGAAATCGG + Intronic
926840389 2:17073317-17073339 CAGTCTTAGAACTGGGTAATGGG + Intergenic
927109403 2:19853433-19853455 CAGTCTGACGTCTGGGAGATGGG + Intergenic
927838652 2:26422470-26422492 CAGCCTGAGACCTGGGACATGGG - Intronic
934603991 2:95680653-95680675 CAGTTTCTCAACTGGAAAATGGG - Intergenic
934898189 2:98136713-98136735 CACTCTCAATACTGTGACATTGG + Intronic
935833655 2:107026174-107026196 CTGTCTCACATCTCGGACTTGGG + Intergenic
935922820 2:108033800-108033822 CAGTGTCTCATCTGGAACATGGG - Intergenic
938537066 2:132256232-132256254 CAATCTCGCAACTGGGACGCCGG - Intronic
938666327 2:133542066-133542088 CAGCCTCACAACTGGGATGCAGG - Intronic
938788800 2:134658504-134658526 GAGTGTGACAACTGGGGCATAGG - Intronic
940614880 2:156037925-156037947 TAGCCTCAAAAATGGGACATGGG - Intergenic
943344960 2:186727435-186727457 CTGTCTCATAAATGGGTCATTGG - Intronic
1170092873 20:12611201-12611223 CAGTCTCAGAAAAGGTACATTGG - Intergenic
1170131243 20:13022573-13022595 CAGTGTCACACCTGGCACCTGGG + Intronic
1171193674 20:23180258-23180280 CAGCCTCCCTGCTGGGACATAGG + Intergenic
1171865979 20:30488011-30488033 CAATCTCACAACTGGGACGCGGG - Intergenic
1173042943 20:39481940-39481962 CAGTTCCAGAAATGGGACATAGG + Intergenic
1174926081 20:54761516-54761538 CAGTATCACAACCAGGATATTGG - Intergenic
1175105223 20:56610281-56610303 CAGACTGACAACTGGGGCAGAGG + Intergenic
1175418041 20:58814681-58814703 AAGGGTCACAGCTGGGACATGGG - Intergenic
1177168424 21:17628801-17628823 CTTTCTAAGAACTGGGACATTGG - Intergenic
1180312688 22:11252885-11252907 CAATCTCGCAACTGGGACGCCGG - Intergenic
1181793162 22:25283212-25283234 CAGTCTCTGAAATGGGGCATCGG + Intergenic
1181813805 22:25421487-25421509 CAGTCTCTGAAATGGGGCATCGG + Intergenic
1181831767 22:25565307-25565329 CAGTCTCTGAAATGGGGCATCGG + Intronic
1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG + Intronic
1183005009 22:34894081-34894103 CAGTCTCTCCCCTGGTACATTGG - Intergenic
1184238770 22:43200623-43200645 CAGTCTCACACCAGGGAACTTGG - Exonic
1184282639 22:43447002-43447024 CCGTCTCACAACTGGGAGGCAGG - Intronic
949408945 3:3743082-3743104 CAGAATCACAACAGGGATATAGG - Intronic
949737391 3:7189334-7189356 CAGTGCCACAACTGGAAGATAGG - Intronic
950737919 3:15025744-15025766 CAGTATCACAACGAGGACATTGG + Intronic
952469212 3:33627966-33627988 CATCCTCACACCTGGGTCATTGG - Intronic
952512016 3:34067620-34067642 CAGACTCATACCTGGGCCATGGG - Intergenic
954095701 3:48326011-48326033 CAGTCTCACAAGTAGGAGATGGG + Intronic
954649826 3:52154300-52154322 CAGTCTCCCCGCTGGGACACTGG - Intronic
961019909 3:123496838-123496860 CAGTCTCACAGCTGGTTCAGAGG + Intronic
961868744 3:129973518-129973540 CAGTCCCACATCTGGGACTTTGG + Intergenic
962071269 3:132035785-132035807 CAGACTCACAAATTGGACTTTGG + Intronic
968351690 3:198061252-198061274 CAGTCTTCCAAGTGGCACATGGG - Intergenic
968900406 4:3428883-3428905 CAGTCTCAAAACTGGGGTTTCGG - Intronic
971225760 4:24750233-24750255 CTGCCTTCCAACTGGGACATTGG - Intergenic
971354267 4:25880200-25880222 CAGTTTCATACCTGTGACATTGG - Intronic
973152737 4:46908647-46908669 CACTCTGACATCTAGGACATAGG - Intronic
974102607 4:57434240-57434262 CAGTGTCAAAATTGGGAGATAGG + Intergenic
974187007 4:58458639-58458661 CAGTCTCACCACTTGGTAATAGG - Intergenic
976499654 4:85772859-85772881 CATTTTCAAAACTTGGACATTGG - Intronic
978694002 4:111553972-111553994 AAGTATCATAACTGGTACATGGG + Intergenic
979983003 4:127279519-127279541 CTGTCTCTGAGCTGGGACATTGG + Intergenic
980323769 4:131313486-131313508 AAGTCTTCCAACTGGGACATGGG + Intergenic
981698767 4:147585248-147585270 CTGTCTTTGAACTGGGACATTGG - Intergenic
983961380 4:173759282-173759304 CATTCTCAGAACTGGGAGACAGG + Intergenic
985937081 5:3105818-3105840 CCGCCTCTCCACTGGGACATTGG - Intergenic
986573465 5:9189061-9189083 CAGTCCCACATCTGGCTCATTGG + Intronic
987210019 5:15671853-15671875 CAATCTCATAAATGGGATATGGG + Intronic
988654722 5:33196759-33196781 CAGTTTCAAAACTGGCAGATTGG + Intergenic
990649313 5:57880401-57880423 CAGTGACAAAACTGGGACACTGG - Intergenic
991950298 5:71940594-71940616 CTGGCTGACAACTGGGGCATTGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994218459 5:97166016-97166038 CTGTCTTTGAACTGGGACATGGG + Intronic
1002347041 5:178555335-178555357 AAGTCTCAGAATTGGGGCATGGG - Intronic
1004460426 6:15829977-15829999 AACTATCACAACTGGCACATGGG - Intergenic
1005675590 6:28151636-28151658 CAGTCTGACTTCAGGGACATCGG + Intronic
1012246664 6:96933675-96933697 CAGTATCTCAGCTGGGACAGAGG + Intronic
1013463208 6:110395285-110395307 CTGCCTTCCAACTGGGACATTGG + Intronic
1015525237 6:134169544-134169566 CTGACTGACAACTGGGGCATTGG + Exonic
1018838249 6:167501093-167501115 CAGTCTCACAGCTGAGACTGAGG + Intergenic
1019390788 7:785734-785756 CAGTCTCACTGCTGGCACAGAGG - Exonic
1019931313 7:4225172-4225194 CAGTCTCACAACTGGGACATGGG - Intronic
1022585635 7:31605966-31605988 CAGTCTCACAGGTGGAACCTTGG + Intronic
1024657770 7:51466513-51466535 CAGTTTCACATCTAGGTCATGGG + Intergenic
1027221667 7:76218096-76218118 CAGGCTCACACCTGGGAGCTAGG - Intronic
1027548696 7:79563425-79563447 CAGTCTCACAAATGGAGAATAGG + Intergenic
1029196452 7:98809000-98809022 CAGGCTTGCAACTGGGACACAGG - Intergenic
1030001567 7:105069727-105069749 CAATATCACAACTAGGATATTGG + Intronic
1037313857 8:17582744-17582766 CAGTCTCTCAACTGTGCCCTTGG - Intronic
1041436633 8:57848872-57848894 CACTCTCATAACTTGGACATGGG - Intergenic
1043421196 8:80100757-80100779 CTGTCTTCCAGCTGGGACATTGG - Intronic
1056509392 9:87288745-87288767 TAGTGTCACAACTGGGATAGGGG - Intergenic
1057293612 9:93822681-93822703 CTGGCTCTCAACTGGGAAATGGG + Intergenic
1057906047 9:98984250-98984272 CTGTCTCACTACTGGTACCTTGG + Intronic
1058460054 9:105174295-105174317 CAGGCTCCCAACTGTGACACAGG - Intergenic
1059425684 9:114219665-114219687 CAGTCTCACTCCTTGGTCATGGG - Intronic
1189052275 X:37658398-37658420 CTGTCTTTGAACTGGGACATTGG - Intronic
1189925590 X:45951003-45951025 CAGTGTGACAATTGGGGCATAGG - Intergenic
1194241751 X:91457622-91457644 CTCTGTCAAAACTGGGACATTGG + Intergenic
1194647293 X:96473034-96473056 CAGTGCCACATTTGGGACATGGG + Intergenic
1196936062 X:120732245-120732267 CAGTATCACAACCAGGATATTGG - Intergenic
1198271424 X:135059683-135059705 CAGTCTCCAATGTGGGACATGGG - Intergenic
1200838879 Y:7759941-7759963 AAGTCTCACCACTGTGACAGTGG - Intergenic