ID: 1019935038

View in Genome Browser
Species Human (GRCh38)
Location 7:4249308-4249330
Sequence GAGCAGGACTGGTGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 707
Summary {0: 1, 1: 0, 2: 2, 3: 83, 4: 621}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019935038_1019935051 24 Left 1019935038 7:4249308-4249330 CCACCTTCCCACCAGTCCTGCTC 0: 1
1: 0
2: 2
3: 83
4: 621
Right 1019935051 7:4249355-4249377 GGCTGAGGTGGCAAGGGGCCTGG No data
1019935038_1019935044 -5 Left 1019935038 7:4249308-4249330 CCACCTTCCCACCAGTCCTGCTC 0: 1
1: 0
2: 2
3: 83
4: 621
Right 1019935044 7:4249326-4249348 TGCTCTCAGAGCTGAGTCTCAGG 0: 1
1: 0
2: 3
3: 24
4: 255
1019935038_1019935052 25 Left 1019935038 7:4249308-4249330 CCACCTTCCCACCAGTCCTGCTC 0: 1
1: 0
2: 2
3: 83
4: 621
Right 1019935052 7:4249356-4249378 GCTGAGGTGGCAAGGGGCCTGGG 0: 1
1: 1
2: 2
3: 34
4: 466
1019935038_1019935045 3 Left 1019935038 7:4249308-4249330 CCACCTTCCCACCAGTCCTGCTC 0: 1
1: 0
2: 2
3: 83
4: 621
Right 1019935045 7:4249334-4249356 GAGCTGAGTCTCAGGCAGCGTGG 0: 1
1: 0
2: 1
3: 23
4: 162
1019935038_1019935050 19 Left 1019935038 7:4249308-4249330 CCACCTTCCCACCAGTCCTGCTC 0: 1
1: 0
2: 2
3: 83
4: 621
Right 1019935050 7:4249350-4249372 AGCGTGGCTGAGGTGGCAAGGGG 0: 1
1: 0
2: 1
3: 25
4: 256
1019935038_1019935048 17 Left 1019935038 7:4249308-4249330 CCACCTTCCCACCAGTCCTGCTC 0: 1
1: 0
2: 2
3: 83
4: 621
Right 1019935048 7:4249348-4249370 GCAGCGTGGCTGAGGTGGCAAGG 0: 1
1: 0
2: 1
3: 34
4: 323
1019935038_1019935046 9 Left 1019935038 7:4249308-4249330 CCACCTTCCCACCAGTCCTGCTC 0: 1
1: 0
2: 2
3: 83
4: 621
Right 1019935046 7:4249340-4249362 AGTCTCAGGCAGCGTGGCTGAGG 0: 1
1: 0
2: 0
3: 16
4: 221
1019935038_1019935049 18 Left 1019935038 7:4249308-4249330 CCACCTTCCCACCAGTCCTGCTC 0: 1
1: 0
2: 2
3: 83
4: 621
Right 1019935049 7:4249349-4249371 CAGCGTGGCTGAGGTGGCAAGGG 0: 1
1: 0
2: 3
3: 20
4: 253
1019935038_1019935047 12 Left 1019935038 7:4249308-4249330 CCACCTTCCCACCAGTCCTGCTC 0: 1
1: 0
2: 2
3: 83
4: 621
Right 1019935047 7:4249343-4249365 CTCAGGCAGCGTGGCTGAGGTGG 0: 1
1: 0
2: 3
3: 28
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019935038 Original CRISPR GAGCAGGACTGGTGGGAAGG TGG (reversed) Intronic
900521177 1:3106199-3106221 GAGCAGCCCTGGTGAGCAGGTGG + Intronic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
900589131 1:3452037-3452059 GGGCCGGGCTGGTGGGAAGAAGG - Intergenic
900594369 1:3473841-3473863 TAGGAGGACTGGTGGGGTGGGGG - Intronic
901081808 1:6587967-6587989 GAGCATGCCTGGTGGAAAGAGGG - Intronic
901184858 1:7366371-7366393 GAGCAGCCCTGGAGAGAAGGGGG - Intronic
901423704 1:9167694-9167716 GAGCAGGTCAGGTGGCCAGGAGG - Intergenic
901496330 1:9624477-9624499 GATCAGGTGTGGTGGGTAGGAGG - Intergenic
901798009 1:11691697-11691719 GAGCGGGACTGGAAGGAAGGGGG - Intergenic
901930426 1:12593502-12593524 GAGCAGAACCTGTGAGAAGGTGG - Intronic
902396021 1:16132850-16132872 GTGCAGGTATGGGGGGAAGGTGG + Intronic
902396059 1:16132979-16133001 GTGCAGGTATGGGGGGAAGGTGG + Intronic
902396083 1:16133066-16133088 GTGCAGGTGTGGGGGGAAGGTGG + Intronic
903215622 1:21841977-21841999 GAGCCAGGCTGGTGGGCAGGTGG - Intronic
903316430 1:22511353-22511375 GAACGGGCCAGGTGGGAAGGGGG + Intronic
903320362 1:22539314-22539336 TTGCAGGACTGGGGGGAAGCTGG - Intergenic
903370143 1:22830045-22830067 AAGTTTGACTGGTGGGAAGGGGG + Intronic
903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG + Intergenic
903807020 1:26012859-26012881 GATCAGGCCTGGAGGGAAGCAGG - Intergenic
904313244 1:29642853-29642875 GTGCAGGAATGGAGGGATGGTGG - Intergenic
904348511 1:29889852-29889874 GAGCAGGAGAAATGGGAAGGAGG + Intergenic
904384107 1:30130447-30130469 GGGGAGGCCTGGTGGGCAGGTGG - Intergenic
904384122 1:30130492-30130514 GGGGAGGCCTGGTGGGCAGGTGG - Intergenic
904688030 1:32274657-32274679 GAGCAGAGCAGGGGGGAAGGGGG + Intronic
905108548 1:35577961-35577983 AAGCAGGACTGGTGGGGAGACGG + Intronic
905371860 1:37486694-37486716 GAGCAGCACTGGCGGGGATGGGG - Intergenic
905452900 1:38068445-38068467 GGGGAGGGCTGGTGGGAGGGAGG + Intergenic
905876558 1:41435454-41435476 GAGCAGGAATGGTGGGGAGCAGG + Intergenic
905958021 1:42015524-42015546 GAGGAGAGCTGGAGGGAAGGAGG - Intronic
906181776 1:43827039-43827061 GAACAGGAGTGGTGAGAGGGGGG - Intronic
906192227 1:43905694-43905716 GAGGAAGAGTGGTGGGAAGGGGG - Intronic
906281805 1:44559637-44559659 GAGCAGGCCTGTTAGGAAGAGGG + Intronic
906572783 1:46858694-46858716 CAGCAGAACTGGGGGGCAGGAGG + Intergenic
906598986 1:47107194-47107216 CAGCAGAACTGGGGGGCAGGAGG - Intronic
906685532 1:47760939-47760961 CAGCAGGACTGGGATGAAGGGGG + Exonic
906687037 1:47769497-47769519 GGGCAGGACTGGTGGGTGGGGGG + Intronic
906832084 1:49043711-49043733 GAGAAGCACTGTTGGGAAGAAGG + Intronic
908014208 1:59814823-59814845 GGGCAGGACGGGTGGGAGGAGGG + Intronic
908082803 1:60598613-60598635 GAAGAGGACGGGAGGGAAGGGGG + Intergenic
908366384 1:63427733-63427755 GAGCAGGAGTTGTGGTAAGGAGG + Intronic
909987399 1:82178575-82178597 GAGCAGGCCTGGGTGGAAGGTGG + Intergenic
911335189 1:96573535-96573557 GGGCAGGACTGGGGAGAAGGAGG - Intergenic
911630423 1:100177257-100177279 GAGCAGGACTGGTGATAGAGAGG + Intronic
911637353 1:100249769-100249791 GAGCAGGAATGCGGGGAAGCTGG - Exonic
912450438 1:109764753-109764775 GAGCAGGGCAGGAGGGGAGGCGG + Intronic
912680616 1:111726797-111726819 GCTCAGGACTGAAGGGAAGGTGG - Exonic
913427799 1:118753889-118753911 GAGCAGGGAAGGTGGGAAGGGGG - Intergenic
914681945 1:149944696-149944718 GAGCTGGAAGGGTGGCAAGGAGG - Exonic
914713284 1:150234632-150234654 GAGCAGGGCTGGTGGCCAGCGGG - Intronic
915044143 1:152997735-152997757 GAGAAGGATTAGTTGGAAGGAGG - Intergenic
915461827 1:156075137-156075159 AAGCAGGACTGGGGGGAGGTGGG - Exonic
916052978 1:161049048-161049070 GAGCAGGCATGCTGGGAAGTTGG - Exonic
917070170 1:171141896-171141918 AAGAAGGAGAGGTGGGAAGGAGG - Intronic
917189592 1:172400433-172400455 GGGCAGGAAAGGAGGGAAGGAGG + Intronic
918239571 1:182609782-182609804 GAGGAGGTATGGTGGGAAAGAGG - Intergenic
918416960 1:184320031-184320053 GAGCAGGACTGGAGGGGTGGGGG - Intergenic
919058043 1:192595353-192595375 GAGCAGGAGGGGTAGGGAGGAGG + Intergenic
919058069 1:192595419-192595441 GAGGAGGAGGGGTGGGGAGGAGG + Intergenic
919612058 1:199757803-199757825 TAGCAGGAATGGTGAGAAGAAGG - Intergenic
919843162 1:201623617-201623639 GAGCAGGCAGGGAGGGAAGGGGG + Intronic
920634485 1:207686188-207686210 GAGAAGGAAAGGAGGGAAGGAGG - Intronic
921622453 1:217340841-217340863 GAGCAGGACTGCTGTGAGTGGGG - Intergenic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
923676296 1:236083393-236083415 GAGCTGGACCCGTAGGAAGGTGG - Intergenic
923706537 1:236348809-236348831 GAGAAGGACTGGAGAAAAGGTGG - Intronic
1062896381 10:1106335-1106357 GAGCAGCACTGGTGGGAGGTAGG - Intronic
1063365357 10:5487136-5487158 GATTAGGACAGGAGGGAAGGTGG - Intergenic
1064016070 10:11773272-11773294 ATGGAGGACTGGTGGGAAGGTGG - Intergenic
1065822957 10:29543265-29543287 AAGCAGGGCAGATGGGAAGGTGG + Intronic
1066994794 10:42553594-42553616 GAAGGGGGCTGGTGGGAAGGAGG + Intergenic
1067036619 10:42925691-42925713 GAGGTGGGCTGGTGGGGAGGGGG - Intergenic
1067208462 10:44239332-44239354 GGGCAGGACTGAGGGGAAGAAGG - Intergenic
1067735757 10:48848925-48848947 GTGCAGGACAGGTGGCAAGTGGG + Intronic
1067808316 10:49408308-49408330 GGCAAGGACTGGTGGGAAGGTGG - Intergenic
1067914669 10:50384473-50384495 AAGCAGGGATGGAGGGAAGGAGG - Intronic
1068816429 10:61320178-61320200 CAGCAGGACTAGCGGGTAGGAGG - Intergenic
1068937330 10:62648693-62648715 GAGCAGGAGTGCAGAGAAGGTGG - Intronic
1069631820 10:69901842-69901864 GGACAGGCATGGTGGGAAGGCGG + Intronic
1069794619 10:71044100-71044122 AGGCAGGACTGGCGTGAAGGTGG + Intergenic
1069821418 10:71230827-71230849 GAGCTTGAGTGGTGGGAAGGTGG - Intronic
1070660948 10:78304835-78304857 CACCAGGACTGGTGGGCAGTGGG - Intergenic
1070679650 10:78439560-78439582 ACCCAGGCCTGGTGGGAAGGTGG + Intergenic
1070763836 10:79045062-79045084 GAGCAGGGGCTGTGGGAAGGTGG + Intergenic
1070814042 10:79312248-79312270 GAGGTGGGCTGGTGGGAAGGCGG - Intronic
1071702540 10:87955596-87955618 GAGAAGGAGTGGTGGGGAGAAGG + Intronic
1072050864 10:91701667-91701689 GAGCATGGCTGGAGGGCAGGTGG + Intergenic
1072190683 10:93074232-93074254 GAGCAGGGCTGGCGGGAGCGCGG + Intronic
1072696759 10:97609615-97609637 GAGGCAGGCTGGTGGGAAGGTGG - Intronic
1072727164 10:97821842-97821864 GAGCAGGAAAGGGGGGCAGGAGG + Intergenic
1072753853 10:98003917-98003939 GCCCAGGACTGGGGAGAAGGAGG + Intronic
1073150099 10:101305617-101305639 GAGGAGGGTTGATGGGAAGGAGG - Intergenic
1073567114 10:104544437-104544459 GAGCAAGACAGGGAGGAAGGAGG + Intergenic
1074155001 10:110790304-110790326 GAGCTGGAATGGTGGGGAGGCGG - Intronic
1074590041 10:114803853-114803875 GAGCAAGACTTGTGGGGTGGGGG + Intergenic
1074860954 10:117510107-117510129 GAGCACTGCTGGTGGGAATGGGG + Intergenic
1075597514 10:123742865-123742887 CAGCAGGACTGGCCAGAAGGAGG - Intronic
1076176743 10:128374021-128374043 GTCCAGCACTGTTGGGAAGGCGG + Intergenic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1076348523 10:129797558-129797580 GAGGAGGAAAGGTGGGAATGAGG - Intergenic
1076802279 10:132836117-132836139 GAGCAGGGCTGCAGGGGAGGGGG - Intronic
1076921455 10:133456634-133456656 GAGGAGGACTGGGAGGATGGCGG + Intergenic
1076985280 11:231693-231715 GGGCAGGCCTTGTGGGAAGGTGG - Intronic
1077095196 11:796159-796181 GAGCAGGACCAGCGGGCAGGTGG - Exonic
1077108569 11:852431-852453 TTGCTGGACTGGCGGGAAGGTGG - Intronic
1077145541 11:1042667-1042689 GAGCAGGACTGGGTGGGGGGTGG + Intergenic
1077214959 11:1391346-1391368 GGGCAGGGGTGGAGGGAAGGAGG + Intronic
1077310326 11:1885907-1885929 GAGGAGTACTGGTTGGATGGAGG - Intronic
1077327971 11:1971841-1971863 GAGGAGGGCTGGTGGGCAGCAGG - Intronic
1077499947 11:2904797-2904819 GAGCAGGGCTGGAAGGAAGCAGG + Intronic
1077868627 11:6243096-6243118 GAGCAGGAACAGAGGGAAGGGGG - Intronic
1078151204 11:8761005-8761027 GAGGAGGAGGGTTGGGAAGGAGG - Intronic
1078660860 11:13284543-13284565 GAGCAGGATGGATGGGAAGTTGG + Intronic
1080023919 11:27594020-27594042 GACCAGCACTTATGGGAAGGAGG + Intergenic
1080889666 11:36398452-36398474 GAGCAGCACAGGGAGGAAGGAGG - Intronic
1081415927 11:42815997-42816019 GAGCAGGTCTAGTAGGAAGTAGG + Intergenic
1081623737 11:44634625-44634647 GACCAGGCCTCCTGGGAAGGGGG - Intergenic
1082847954 11:57741548-57741570 CAGCGGGACTGGTGGGTGGGGGG - Intronic
1083174000 11:60938189-60938211 GAGCAGGGCAGAGGGGAAGGCGG - Intronic
1083185089 11:61012805-61012827 GGGGATGTCTGGTGGGAAGGAGG + Intronic
1083293115 11:61700698-61700720 GTGCAGGACTGCAGGGAGGGAGG - Intronic
1083329471 11:61890930-61890952 GAGCAGGTCTGCGGGGGAGGAGG - Intronic
1083860678 11:65418425-65418447 GCCCAGGACAGTTGGGAAGGAGG + Intergenic
1084164754 11:67370382-67370404 GGCCAGGACTGGTGGGGAGGGGG - Intronic
1084175291 11:67419637-67419659 GAGCAGGGCAGCTGGGCAGGTGG - Exonic
1084433554 11:69124645-69124667 GAGGAGGAGGGGTAGGAAGGAGG + Intergenic
1084575186 11:69984615-69984637 CAGCAGGCCTGGTGGGGAGGAGG + Intergenic
1084729951 11:71066389-71066411 GAGCAGGGAAGGTGGGCAGGGGG + Intronic
1084733895 11:71092096-71092118 GGGCAGGGCTCCTGGGAAGGGGG + Intronic
1085523874 11:77153339-77153361 GAGCAGGGTTGGAGGGAAGGGGG + Intronic
1085630544 11:78112297-78112319 GAATAGGAATGGTGAGAAGGGGG + Intronic
1086238853 11:84664632-84664654 AAGCAGGACAGATGGGAAGTAGG + Intronic
1086399802 11:86451255-86451277 TAGCAAGACTGGTGATAAGGAGG + Intronic
1088256826 11:107911066-107911088 GGGCAGCAATGGTGGGGAGGTGG - Intronic
1088799126 11:113289517-113289539 TTGCAGGACTGGTGAGCAGGTGG - Intergenic
1088832291 11:113547661-113547683 CAGTAGGACAAGTGGGAAGGTGG - Intergenic
1089146369 11:116332242-116332264 GAGCTGGACTGGGAGCAAGGTGG + Intergenic
1089313290 11:117574056-117574078 GAGCTGGATGGGAGGGAAGGGGG + Intronic
1089401081 11:118165083-118165105 GAGGAGGAGTGGAGGGAAGCAGG - Exonic
1089509167 11:118985018-118985040 GTGCAGGCCTGTTGGGCAGGAGG - Intergenic
1089803993 11:121066099-121066121 GAGCAGGATTGATGGGAAGCAGG + Intronic
1089966684 11:122659334-122659356 GAGCAGGCCTGGAGAGAGGGAGG + Intronic
1090199666 11:124845371-124845393 GAGTCAGACTGGTGGGAAGGTGG - Intergenic
1090402850 11:126460106-126460128 GAGCAGGAGGAGGGGGAAGGGGG + Intronic
1090435609 11:126684156-126684178 GTGCAGGGCTGATGGGAAGGAGG + Intronic
1091126153 11:133100166-133100188 GAGCAGGAAGGGTGGAAAGAGGG + Intronic
1091150181 11:133321089-133321111 GACCAGAACTTGGGGGAAGGTGG + Intronic
1091300579 11:134504668-134504690 GAGGAGCAAGGGTGGGAAGGGGG + Intergenic
1091349172 11:134879384-134879406 GAGCAGGACTTGGGGGCAGGGGG + Intergenic
1202810950 11_KI270721v1_random:27021-27043 GAGGAGGGCTGGTGGGCAGCAGG - Intergenic
1091596993 12:1884939-1884961 GGGGAGGACTGGGAGGAAGGCGG - Intronic
1093152022 12:15633034-15633056 AGGCAGGACAGGAGGGAAGGAGG + Intronic
1093502211 12:19826280-19826302 GAGCAGGGAGGGTGGGAAGAGGG + Intergenic
1094765416 12:33588852-33588874 GAGCAGGAGTGGTGGACTGGTGG + Intergenic
1095397430 12:41776712-41776734 GAGCAGCATTGGTGGGGAGGTGG - Intergenic
1095527394 12:43143620-43143642 GAGGAGGACTTGTGGGATGTTGG - Intergenic
1095751274 12:45713880-45713902 GTTCATGAGTGGTGGGAAGGAGG - Intergenic
1096591024 12:52659360-52659382 GAGCAGGAAGGTTGGGCAGGGGG + Intergenic
1097440258 12:59599204-59599226 AAGCAGAACTAGAGGGAAGGAGG + Intronic
1097959229 12:65516180-65516202 CAGCAGAAGTGATGGGAAGGTGG - Intergenic
1101340721 12:103840505-103840527 GAGCGGGGCTGCTGGGGAGGTGG - Intronic
1101434824 12:104655493-104655515 GAGCAGGAGTCCTGGGGAGGTGG + Intronic
1101824654 12:108210550-108210572 GAGGAAGACTGGTGAGAATGAGG - Intronic
1102040234 12:109796315-109796337 GAGCAAGACTTGTGGGAAGATGG - Intronic
1102046477 12:109833079-109833101 TAGCAGGTCTGGGGGGAGGGCGG - Intronic
1102643036 12:114383286-114383308 GAGATGGCCTGGTGAGAAGGAGG + Intronic
1103245119 12:119450250-119450272 GACCAGGAAGGGTGGGAGGGTGG + Intronic
1104074521 12:125377364-125377386 GGGCTGGACTGGGGAGAAGGTGG + Intronic
1104558344 12:129822203-129822225 GAGCAGGGCTGGAGGGGAGAAGG + Intronic
1104570476 12:129920651-129920673 GAGCAGGCTTGTGGGGAAGGAGG - Intergenic
1104731717 12:131108885-131108907 GGGCAGGGCAGGTGGGATGGCGG + Intronic
1104946525 12:132417137-132417159 AACCAGGCCTGGTGGGCAGGAGG + Intergenic
1105389472 13:19960296-19960318 GAGGAGGGGTGGTGCGAAGGAGG + Intronic
1106264057 13:28093904-28093926 AAGGAGGAAGGGTGGGAAGGAGG + Intronic
1106618420 13:31351977-31351999 GAGCATGACTGTTGGCAAAGCGG + Intergenic
1107368341 13:39711596-39711618 GAGTAAGACTGATGAGAAGGAGG - Intronic
1107814120 13:44228996-44229018 GGGCTGGAGTGGTGAGAAGGAGG - Intergenic
1107977268 13:45702325-45702347 GAGCATCACAGGTGGGAATGAGG - Exonic
1107995238 13:45852769-45852791 GAACAGGGCTGGTGGGTGGGCGG + Intergenic
1108056270 13:46488444-46488466 GTTCATGACAGGTGGGAAGGAGG + Intergenic
1109237492 13:59842818-59842840 GACAAGGAATGGTGGGACGGGGG + Intronic
1111426195 13:88086521-88086543 GAGCAGGATTTGAAGGAAGGAGG + Intergenic
1111685174 13:91492934-91492956 GAGAAGCACTGGGGGGAAAGAGG - Intronic
1111883403 13:93987933-93987955 GAGCAGGACAAGAGGCAAGGAGG - Intronic
1112636979 13:101226609-101226631 GAGCAGGACTCCTGGAACGGAGG - Intronic
1113069523 13:106406927-106406949 GAGCAGGACAGGAGGGAGGGAGG - Intergenic
1113425749 13:110207106-110207128 GAGCTGGGCTGGGGGGCAGGAGG - Intronic
1113439759 13:110319095-110319117 CAGCAGGACTGGTGGGTGCGGGG + Intronic
1113814471 13:113161750-113161772 GAGGAGGACGGGGGGGCAGGGGG - Intronic
1113891495 13:113737932-113737954 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1114523167 14:23351713-23351735 GGGCAGGGCTGGTAGAAAGGAGG - Intronic
1115853594 14:37606374-37606396 GTGCAGGACTGAAGGGCAGGAGG + Intronic
1115876883 14:37870848-37870870 AAGCAGGGCTGCTGAGAAGGGGG - Intronic
1116390766 14:44386212-44386234 GAGACAGCCTGGTGGGAAGGGGG - Intergenic
1116972043 14:51076359-51076381 GAGCAGGAATGGAGGAATGGAGG - Intronic
1117406141 14:55405938-55405960 GTTCAGGACTGGGGGCAAGGTGG + Intronic
1117803566 14:59467863-59467885 GATGTGGACTGGTGGTAAGGAGG - Intronic
1118001581 14:61528069-61528091 GACCAGGAGGGGTGGGGAGGGGG - Intronic
1118390422 14:65291054-65291076 GAGCAGGGTTGGTGGGGTGGAGG + Intergenic
1118471328 14:66077766-66077788 GTGCAACACTGGTGTGAAGGAGG - Intergenic
1118610759 14:67537807-67537829 GAGTAGGATGGGTGGGAAGGTGG - Intronic
1119181978 14:72611509-72611531 GAGCGGGACTGGGGGGGTGGGGG - Intergenic
1119195783 14:72715819-72715841 GAGGGAGACTGGTGGGAGGGAGG - Intronic
1119328611 14:73777296-73777318 GATCAGGACTTGTGGAAAGTTGG - Intronic
1119771247 14:77221570-77221592 GGGCAGGCTTGGTGGGAGGGGGG - Intronic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1120143603 14:80955565-80955587 GAGCGGGAGGGGTGGGAAGAGGG - Exonic
1120635556 14:86946382-86946404 GAGAGGGACTGGAGGGAGGGAGG - Intergenic
1120781705 14:88491323-88491345 GATCAGGACTGGGGGTAAAGGGG + Intronic
1121339919 14:93099136-93099158 GAGCAGGCCTGGTGGAACTGCGG - Intronic
1121472402 14:94165723-94165745 GTGCAAGACAGGTGAGAAGGGGG - Intronic
1121779149 14:96610727-96610749 CAGGAGGACTGGTGGAAAGTTGG - Intergenic
1121826126 14:97010973-97010995 GAGCAGGCTTGGAGGGAAGGGGG + Intergenic
1121892279 14:97605366-97605388 GTGCAGGAGAGGTGGGAAAGTGG - Intergenic
1122601281 14:102923127-102923149 GCGCCGGCCTGGTGTGAAGGCGG - Intronic
1122603533 14:102932863-102932885 GGGCAGGACTGGTGGGGGGGGGG + Exonic
1122648279 14:103209461-103209483 GGGCAGGACTGTTGGGGTGGGGG - Intergenic
1122902300 14:104786931-104786953 GGGCAGGCCTGGCGGGGAGGTGG - Intronic
1123071972 14:105646442-105646464 GAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123091902 14:105745655-105745677 GAGCAGGGCCGGTGGGAAGCAGG - Intergenic
1123097487 14:105773385-105773407 AAGCAGGGCTGGTGGGAAGCAGG - Intergenic
1123097541 14:105773617-105773639 GAGCATGGCTGGTGGGAGGTGGG - Intergenic
1125404109 15:39335204-39335226 GAGGAAGAGTGGTGGGAATGAGG - Intergenic
1125493045 15:40162721-40162743 GAGCAGGTCTGGGAGGAAGTGGG + Intronic
1125726526 15:41871123-41871145 GAGCAGGAGCTGTGGGAAGATGG - Intronic
1125800193 15:42439277-42439299 CAGCAGGACTGGTCGGGAGCAGG - Exonic
1127261671 15:57331285-57331307 GTGCAGGATAGGTGGGAAGCAGG + Intergenic
1128181637 15:65610464-65610486 GAACAGTACACGTGGGAAGGGGG - Intronic
1128308157 15:66613622-66613644 GAGCCAGACTGATGGGAAAGGGG + Intronic
1128324774 15:66717198-66717220 GAGCATGGCTGGTGGCATGGTGG + Intronic
1128459372 15:67854730-67854752 GGGCAGGACTGATGAGGAGGTGG + Intergenic
1128551533 15:68600904-68600926 CAGCAGGACAGCCGGGAAGGTGG - Intronic
1128637532 15:69312759-69312781 GAGCAATACTGGTTGGATGGTGG + Intronic
1129688539 15:77700149-77700171 GAGCAGGTTTGATGGGCAGGAGG - Intronic
1129856742 15:78830426-78830448 AAGCAGGGCTGGCGGGCAGGGGG + Intronic
1130847155 15:87758169-87758191 GAGAAGGAAAGGAGGGAAGGAGG + Intergenic
1131054640 15:89368276-89368298 GAGGAGGACTGGGGGAAAGCTGG - Intergenic
1131065185 15:89430148-89430170 GACCTGGCCTGGTGGGGAGGTGG - Intergenic
1131454241 15:92570869-92570891 GAGCAGGTTGGGTGGGAAAGAGG - Intergenic
1131693843 15:94855205-94855227 GAGCAGCCATGGTGGGAAAGAGG - Intergenic
1132789151 16:1675445-1675467 GAAGAGGAATGGTGGGGAGGAGG - Exonic
1132878308 16:2149877-2149899 GAGCTGGCCTGGTCAGAAGGGGG - Intronic
1132944854 16:2527257-2527279 GAGCAGGGCTGGGAGGCAGGAGG - Intronic
1133023142 16:2975649-2975671 GAGCAGGCCTGGGAGGAGGGCGG - Exonic
1133129946 16:3670859-3670881 GAGCAGGTCTGGGGAGATGGTGG - Intronic
1136228191 16:28872713-28872735 GAGCAGGTCTGCAGGGGAGGAGG + Intronic
1137293169 16:47066002-47066024 GAGTGAGACTGGTGGCAAGGAGG + Intergenic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1138278440 16:55753905-55753927 GAGCCTGACTGGTGGGATGGAGG - Intergenic
1138448269 16:57078044-57078066 ATGCAGGGCTGGTGGGGAGGAGG + Intronic
1138537617 16:57668210-57668232 GAGCAGGAAGGGTGAGAAAGAGG + Exonic
1138620967 16:58211056-58211078 GAGGAGGATGGTTGGGAAGGTGG + Intergenic
1139480403 16:67227358-67227380 GAGCTGGGCTGGGGGGATGGCGG + Intronic
1139546938 16:67653816-67653838 GAGCAGAGCTGGTGGCAAGTGGG + Intronic
1140027344 16:71302820-71302842 GAGCAGGATTGCTGGAATGGTGG + Intergenic
1140771013 16:78204051-78204073 GGACAGGAATGGTGAGAAGGTGG + Intronic
1141046951 16:80723895-80723917 GAGGAGAAATGGGGGGAAGGAGG + Intronic
1141623559 16:85249702-85249724 CAGCAGGACATTTGGGAAGGGGG + Intergenic
1141713937 16:85716355-85716377 GAGGAGGAAGGGAGGGAAGGAGG + Intronic
1141752812 16:85970439-85970461 GCTCAGGACTGGTGGTAGGGAGG - Intergenic
1141960679 16:87405581-87405603 GAGCAGGCCTGCTGCGGAGGTGG - Intergenic
1142182287 16:88677102-88677124 GAGCAGGACTCCAGGGAGGGGGG + Intergenic
1142262659 16:89050159-89050181 GAGTAGGAAGGGTGGGCAGGGGG - Intergenic
1142477344 17:196907-196929 GAGGAGGATGGGTGGAAAGGGGG + Intergenic
1142553514 17:755961-755983 GAGCAGGAAGGGAGGGAAGAGGG - Intergenic
1142608518 17:1095577-1095599 CAGCAGGACTGGGGAGGAGGGGG - Intronic
1142664606 17:1455693-1455715 GAGCAGGAGTGTGGGGGAGGAGG - Intronic
1143447943 17:7019830-7019852 GAGCAGGGCTGGCGGGAGGCAGG - Intergenic
1144502655 17:15802688-15802710 AAGAAGGCCTGGTGGGGAGGAGG + Intergenic
1144672796 17:17142426-17142448 GCGCAGGCCTGATGGGAGGGAGG + Intronic
1144777633 17:17792786-17792808 GAGCAGGCAGGGTGGGGAGGTGG + Intronic
1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG + Intronic
1145741292 17:27276868-27276890 GAGAAGGACTTGGGGGAAGGCGG - Intergenic
1145796508 17:27658678-27658700 GATCAGGGCTGGTGGGCAGTGGG - Intergenic
1145810943 17:27763953-27763975 GATCAGGGCTGGTGGGCAGTGGG - Intronic
1146169388 17:30621311-30621333 GAGCAGTATGGGGGGGAAGGTGG + Intergenic
1146170174 17:30626138-30626160 GAGCAGTATGGGGGGGAAGGTGG - Intergenic
1146184861 17:30718150-30718172 GAGTAGAAGTGATGGGAAGGTGG + Intergenic
1146332219 17:31937080-31937102 GAGGAGGAGAGGAGGGAAGGAGG - Exonic
1146343626 17:32042167-32042189 GAGCAGTATGGGGGGGAAGGTGG - Intronic
1147304929 17:39556656-39556678 GAGCAGGATTGTTGGCAGGGAGG - Intronic
1147608934 17:41790145-41790167 GTGAGGGACTGGTGGGAGGGAGG + Intergenic
1148130201 17:45257708-45257730 GAGCAGGAATGGGGAGATGGGGG - Intronic
1148222915 17:45876860-45876882 GGGAAGGGCAGGTGGGAAGGAGG + Intergenic
1148645677 17:49218570-49218592 GAGAACTACTGGTGGGAAGGAGG - Intronic
1148921060 17:51034607-51034629 AAACTGGACTGGAGGGAAGGAGG + Intronic
1149451176 17:56751256-56751278 GAGCTGGCCTGGAGGGCAGGAGG - Intergenic
1149884523 17:60327543-60327565 GAGCAGCACGGTTGGGCAGGAGG + Intronic
1149986617 17:61352532-61352554 GAGTAGAAGTGGAGGGAAGGAGG + Intronic
1150141497 17:62733556-62733578 GAGCTGGGCTGGTGGGCTGGTGG - Intronic
1150285302 17:63950694-63950716 GAGCTGGACAGTGGGGAAGGGGG + Intronic
1151190159 17:72392530-72392552 GAGCAGAGCTGGTGGGGACGTGG + Intergenic
1151336074 17:73440535-73440557 GTACAGGACTGGAGGGAGGGTGG - Intronic
1151476132 17:74345195-74345217 GAGCAGGGTTGGGGGGAATGGGG + Intronic
1151500718 17:74486687-74486709 GTGCAGGAATGGTGGGAATGGGG - Intergenic
1151563773 17:74885604-74885626 GTGCAGGAGTGGTGGGCAGCAGG - Intronic
1151881252 17:76896106-76896128 GGGCTGGACTGGGGGGATGGTGG - Intronic
1151892964 17:76962028-76962050 GGGCAGGGCTGGGGGAAAGGAGG - Intergenic
1152125355 17:78443439-78443461 GACCGGGAGTGGTGGGGAGGAGG - Intronic
1152336166 17:79701181-79701203 GAGGAGCACAGGTGGGAGGGTGG + Intergenic
1152336201 17:79701271-79701293 GAGGAGCACAGGTGGGAGGGTGG + Intergenic
1152336220 17:79701325-79701347 GAGGAGCACAGGTGGGAGGGTGG + Intergenic
1152336231 17:79701355-79701377 GAGGAGCACAGGTGGGAGGGTGG + Intergenic
1152336310 17:79701557-79701579 GAGGAGCACAGGTGGGAGGGTGG + Intergenic
1152336343 17:79701647-79701669 GAGGAGCACAGGTGGGAGGGTGG + Intergenic
1152756891 17:82090730-82090752 GGGCAGGACGGGAGGGGAGGAGG - Intronic
1152863361 17:82708962-82708984 GGGCAGGGCAGGTGGCAAGGGGG - Intergenic
1153242468 18:3043258-3043280 GAGGAGGACTTGTGGGGAGGGGG + Intergenic
1153612689 18:6902697-6902719 GTGCACCACTGGTGGGAAGTGGG + Intronic
1154177565 18:12094768-12094790 GTGCAGGACTGGTGTGGGGGTGG + Intronic
1154268337 18:12898088-12898110 GAGCAGCAGTGCAGGGAAGGAGG - Intronic
1155096221 18:22559216-22559238 GAGGAGGGCTGGTGGGAGGATGG + Intergenic
1155198095 18:23493826-23493848 GAGGAGGCCTGGTGTGGAGGAGG - Intergenic
1156798579 18:41079675-41079697 GAGGAGGAAGGGTGGGAAGGAGG - Intergenic
1157476854 18:48029215-48029237 GAGAAGGACTGGAGGGCTGGTGG + Exonic
1157516688 18:48316336-48316358 GAGGAGGAGTGGTGGGGAGATGG - Intronic
1157544676 18:48539445-48539467 GAGCAGGGATGGGGGGAAGGGGG - Intronic
1157557007 18:48619523-48619545 GGCCGGGACTGGTGGGAAAGAGG - Exonic
1157620035 18:49011642-49011664 GAGCAGGGCTGGTCGGGCGGTGG - Intergenic
1158411273 18:57208210-57208232 GAGCAGTACTGATGGGAGGCGGG + Intergenic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1158989839 18:62856894-62856916 GGTCAAGACTGCTGGGAAGGTGG - Intronic
1159553950 18:69925708-69925730 GAGCGAGACTGGAGTGAAGGAGG - Intronic
1160210444 18:76873943-76873965 GAGGAGGACAGGCGGGCAGGAGG - Intronic
1160210474 18:76874085-76874107 GAGGAGGACAGGCGGGCAGGAGG - Intronic
1160225468 18:77008213-77008235 GAGCAGTGCTGGCGAGAAGGAGG - Intronic
1160366446 18:78329872-78329894 GAGCAGAACTGGAGAGCAGGTGG + Intergenic
1160488128 18:79312046-79312068 GGGAATGACTGGAGGGAAGGCGG - Intronic
1160669175 19:348675-348697 AAGCAGGGCTGGAGGGAGGGAGG - Intergenic
1160684520 19:427362-427384 GAGAAGGGCTCGTGGGAACGAGG + Intronic
1160717138 19:581605-581627 GAGCAGGGCATGTGGGCAGGAGG - Intronic
1160963632 19:1735915-1735937 GAGGAGGCCAGGAGGGAAGGGGG + Intergenic
1161463486 19:4413419-4413441 GAACAGGGGTTGTGGGAAGGGGG - Intronic
1161477794 19:4496048-4496070 GCCCAGGACTGCTGGGCAGGAGG + Intronic
1161615797 19:5269508-5269530 GCTCAGGGCTGGTGGCAAGGTGG + Intronic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1161810495 19:6468518-6468540 GGCCAGGACTGATGGGGAGGAGG - Intronic
1161990643 19:7682173-7682195 GAGCAGGCCGGGAGGAAAGGAGG - Intronic
1162146019 19:8612352-8612374 GAGAGGCCCTGGTGGGAAGGAGG - Intergenic
1162365770 19:10248332-10248354 GAGAAGAACTGGGGGGTAGGGGG + Intergenic
1162526611 19:11210088-11210110 GAGGTGGACAGGTGAGAAGGTGG - Intronic
1162789873 19:13057283-13057305 GAGCAGGAGTGCTTGGAGGGAGG + Intronic
1162973920 19:14197545-14197567 GAGTAGAAGTGATGGGAAGGTGG - Intronic
1163148989 19:15400109-15400131 GAGGAGGAAGAGTGGGAAGGGGG + Intronic
1163450977 19:17377319-17377341 GAGCAGGCCTGGTGGTGAGCAGG - Exonic
1163591550 19:18196889-18196911 GAACAGGTCTGGTGGGCGGGGGG + Exonic
1164744224 19:30599351-30599373 GAGGAGGAAGGGAGGGAAGGAGG - Intronic
1165771073 19:38380649-38380671 GAGCAGGCTTGGGGGGAGGGAGG + Intronic
1165942906 19:39424175-39424197 AAGCTGGAGTGGTGGGAACGTGG - Exonic
1166105241 19:40594919-40594941 GAGCAGGAGTGGGGGGTGGGGGG + Intronic
1166180758 19:41106853-41106875 GTGGAGGACTGGGGGGAAGGTGG - Intergenic
1166197093 19:41214245-41214267 GGGCAGGAGTAGAGGGAAGGTGG - Intergenic
1166706403 19:44910379-44910401 GTGCAGGGTGGGTGGGAAGGAGG - Intergenic
1167567852 19:50268034-50268056 GGGCAGGACTGAGGGGCAGGAGG - Intronic
1167578861 19:50330620-50330642 GATGAGGACTGGTGAGGAGGGGG + Intronic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1168095159 19:54110249-54110271 GAGCCGGAGGGATGGGAAGGTGG - Intronic
1168301927 19:55409795-55409817 AAGCAGGACTGGTGGCATAGCGG - Intergenic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925617647 2:5758905-5758927 GACCAGGACTGGGGGAAAGGAGG - Intergenic
925876694 2:8317352-8317374 GGGCAGGAATGCTGGAAAGGAGG + Intergenic
925914528 2:8595430-8595452 GAGCAGGAAGAGTGGGAAGCGGG - Intergenic
926108331 2:10166338-10166360 GAGCAGGGCTGGTGGACAGCAGG - Intronic
926169794 2:10545609-10545631 GTGCAGGACTGGAAGGTAGGCGG - Intergenic
926707840 2:15849282-15849304 GAACAGGAATGGTGGCAAGGGGG + Intergenic
926798982 2:16642274-16642296 GAGCAGGATTGGGAGGAAAGAGG - Intronic
927471836 2:23383558-23383580 GAGCAGGAGTGGGGGGGAGGGGG - Intergenic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927804415 2:26133452-26133474 GAGCAGTACTGGCAGGAAAGGGG + Intronic
927868470 2:26608261-26608283 GAGTGGGTCTGGTGAGAAGGGGG + Intronic
928424472 2:31166707-31166729 GATGAGGGCTGGTGGGAAGGGGG + Intergenic
929411811 2:41705162-41705184 AAGCAGGAGTGGTGGGCAGGAGG - Intergenic
929564383 2:42975450-42975472 AAGCAGGACTGGAGGGCTGGAGG - Intergenic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
932231906 2:70089707-70089729 GGGCAGCAGGGGTGGGAAGGGGG + Intergenic
932405527 2:71510545-71510567 GAGCAGCACTGGTGGAAAGCAGG - Intronic
932890581 2:75593045-75593067 GAGAAGGAAGGGTGGGAAGGTGG - Intergenic
934511293 2:94946561-94946583 GAAGAGGACGAGTGGGAAGGGGG - Intergenic
934617730 2:95785292-95785314 AAGCAGGTATGGTGGGAAGTTGG + Intergenic
934643163 2:96039267-96039289 AAGCAGGTATGGTGGGAAGTTGG - Intronic
934853041 2:97713286-97713308 AGGCAGCAGTGGTGGGAAGGAGG - Intergenic
934892817 2:98085758-98085780 GAGCAGGCATGGGGTGAAGGTGG + Intergenic
935046882 2:99490322-99490344 GAGCAGGACGGGCGGGCAGGCGG - Intergenic
935414364 2:102799901-102799923 GAACAGGACTGGGAGGCAGGAGG + Intronic
935645274 2:105329531-105329553 GAGCAGGAGTGGGGGGTAGGCGG - Intronic
936471581 2:112803241-112803263 AAGCTGGACAGGTGGGATGGTGG + Intergenic
936531653 2:113280270-113280292 GAGAAAGACTGGGTGGAAGGAGG - Intergenic
937126913 2:119480938-119480960 GAGCAGGGCAGCTGGCAAGGTGG - Intronic
937206166 2:120238536-120238558 GAGCAGGGCTGGGGTGGAGGAGG + Intergenic
937450798 2:122000781-122000803 GTGCAGGGCTGATGGGGAGGCGG - Intergenic
937785959 2:125898458-125898480 GAGTAGGAGTGGTGGTAAGCAGG + Intergenic
937901659 2:127024713-127024735 CTGCAAGACTCGTGGGAAGGAGG + Intergenic
938235935 2:129707576-129707598 GAGCAGCACTGGGGGGTGGGGGG - Intergenic
938287629 2:130130433-130130455 GAAGAGGACGAGTGGGAAGGGGG + Intergenic
938427964 2:131208426-131208448 GAAGAGGACGAGTGGGAAGGGGG - Intronic
938711714 2:133981070-133981092 GAGCAAGACAGGTGGGCTGGAGG + Intergenic
939705439 2:145446920-145446942 GAGCAAGAATGGGGGGCAGGTGG + Intergenic
939874532 2:147562560-147562582 GAACAGGATTGATTGGAAGGGGG - Intergenic
939967244 2:148622532-148622554 GAGCAGGACAGATGGGAACATGG + Intergenic
940851897 2:158695445-158695467 AAGCAGAAGTGTTGGGAAGGAGG + Intergenic
941045593 2:160671759-160671781 GTGCAGTACTTGAGGGAAGGTGG + Intergenic
941666165 2:168246538-168246560 GAGCCGGACTGGGCGGCAGGCGG + Intronic
942965629 2:181890021-181890043 GATCAGGAGTGGTGGAATGGTGG + Intergenic
943288851 2:186042577-186042599 GAGCAGGACAAGTGGAAATGTGG - Intergenic
944288782 2:197980206-197980228 GAGCAGGCGAGGTGGGAAGTGGG + Intronic
945075093 2:206030941-206030963 GAGCAGGACTGGAGAGCATGAGG + Intronic
945668006 2:212765892-212765914 GAGGAGGACTGGTGTGTGGGGGG - Intergenic
946435062 2:219645966-219645988 GCTCAGAGCTGGTGGGAAGGTGG + Intergenic
946488660 2:220126215-220126237 GAGGAGGACTGCAGGGAAGAAGG + Intergenic
946653249 2:221916934-221916956 GAGAATGAAGGGTGGGAAGGTGG - Intergenic
947868505 2:233418720-233418742 GAGCAGCTTTGGGGGGAAGGAGG - Intronic
947870994 2:233437917-233437939 GACAAGTACTGGTGGAAAGGGGG + Intronic
947988007 2:234465363-234465385 GAGCGGGACTGGGGGGCGGGGGG - Intergenic
948045446 2:234940237-234940259 TAGGAGGGCTGGTGGGAGGGCGG + Intergenic
948358224 2:237397509-237397531 GAGGAGGCAAGGTGGGAAGGTGG + Intronic
948865141 2:240771396-240771418 GGGCAGGCCTGGGGGGCAGGCGG - Intronic
949041777 2:241852931-241852953 GAGCAGGGCTGGGGAGAAGGTGG + Exonic
1168893822 20:1310477-1310499 GAGCAGGACTGGAGGCAACCTGG + Exonic
1168923226 20:1558342-1558364 GAGGAGGCCTGCAGGGAAGGCGG + Exonic
1169196077 20:3682490-3682512 GGGCAGGACGGGTAGCAAGGAGG - Intergenic
1169804541 20:9545819-9545841 GAACAGGACTGATAGGAAAGGGG - Intronic
1170764473 20:19278402-19278424 GAGAAGGATTTGTGAGAAGGTGG - Intronic
1171380800 20:24732635-24732657 GAGCAGGACTGGGGAGTGGGAGG - Intergenic
1172389900 20:34559320-34559342 GAGCAGGGCGGGCGGGCAGGGGG - Intronic
1172648593 20:36487198-36487220 GAGCAAGGCTGATGTGAAGGAGG + Intronic
1172714399 20:36951924-36951946 GGGCAGTGCTGGTGGAAAGGGGG + Intergenic
1172863493 20:38076648-38076670 GGGCAGGGGTGGGGGGAAGGGGG - Intronic
1173190909 20:40875066-40875088 GGGCTGGGCTGGTGGGATGGGGG - Intergenic
1173825224 20:46043812-46043834 GTGCAGGAAGGGTGGGGAGGGGG + Intronic
1173860799 20:46282303-46282325 GAGCAGCACTGGGGAGAAAGGGG + Intronic
1174143633 20:48434917-48434939 GTCCAGGACTCTTGGGAAGGAGG - Intergenic
1174359343 20:50018082-50018104 GAGTAGGAATGGAGGGAGGGAGG - Intergenic
1174557898 20:51408883-51408905 CAGCAGGACTGGGGTGGAGGTGG + Intronic
1175121842 20:56721901-56721923 GGGTAGGACGGGAGGGAAGGCGG - Intergenic
1175422093 20:58840931-58840953 GAGCAGCGCAGGTGGAAAGGAGG + Intronic
1175810690 20:61855823-61855845 GCTCAGGAATGGTGGGAAGAAGG - Intronic
1175828762 20:61950949-61950971 GCCCAGGGCTGGTGGGAGGGAGG - Intergenic
1175959309 20:62627004-62627026 GGGCAGGAGGGGTGGCAAGGAGG - Intergenic
1176949720 21:15030718-15030740 GAGGAGGATAGGTGGTAAGGAGG + Intronic
1179166528 21:38939392-38939414 GAGAAGGAATGAAGGGAAGGGGG + Intergenic
1179396360 21:41043848-41043870 GTGCTGAACTGGTGGTAAGGAGG - Intergenic
1179810581 21:43866583-43866605 GAGGAGGATTGGTTGGAAAGAGG - Intronic
1180072804 21:45445121-45445143 GGCCAGGACTGGAGGGAGGGAGG - Intronic
1180143857 21:45909070-45909092 GTGGAGACCTGGTGGGAAGGGGG - Intronic
1180783913 22:18536430-18536452 GGGCAGGATTGTGGGGAAGGTGG + Intergenic
1180835068 22:18925714-18925736 GTGCAGGACCTGTGGGAAGGAGG + Exonic
1181086569 22:20442251-20442273 GAGAAGGACTGCTGGGAGGAAGG - Exonic
1181240812 22:21475782-21475804 GGGCAGGATTGTGGGGAAGGTGG + Intergenic
1181312404 22:21952503-21952525 GGGCAGAACTGGGGGGCAGGCGG - Intronic
1181558837 22:23687994-23688016 GAGTAGGACTTATGGAAAGGAGG + Intergenic
1181597369 22:23925103-23925125 GATTAGAGCTGGTGGGAAGGGGG - Intergenic
1181978929 22:26752459-26752481 GAGCAGGAATGGTGGACATGTGG + Intergenic
1182069754 22:27455259-27455281 TAGCAGGACTGGGGAGCAGGGGG - Intergenic
1182624141 22:31633790-31633812 GTGGAGGTCTGGTTGGAAGGTGG - Intronic
1182654637 22:31880266-31880288 CTGCAGGAATGGTGGAAAGGAGG - Intronic
1183489396 22:38108592-38108614 GATCAGCACTGGTGGGTAGTGGG + Intronic
1183989455 22:41588655-41588677 TAGCAGGACTGGAGCAAAGGTGG - Intronic
1184092896 22:42301668-42301690 GAGCAGCAAGGGAGGGAAGGTGG + Intronic
1184301160 22:43561933-43561955 GAGCAGGGCTGCAGGAAAGGCGG + Intronic
1184556531 22:45236207-45236229 GAGCAGGACTGAAGGAAACGCGG + Intronic
1184777159 22:46628930-46628952 GACCAGCTCTGGTGGGCAGGTGG + Intronic
1185345472 22:50308707-50308729 GGGCAGGTCTGGGTGGAAGGCGG - Intergenic
1203285157 22_KI270734v1_random:151013-151035 GTGCAGGACCTGTGGGAAGGAGG + Intergenic
949281558 3:2352778-2352800 GTGCGGGACTGGTGGGCAGCAGG + Intronic
949677599 3:6474616-6474638 GAGCCTGACTGATGGGAAGGAGG - Intergenic
950053574 3:10009303-10009325 GAGGAGGTCTGGGGGGAAAGGGG - Intronic
950534014 3:13569151-13569173 CATGAGGACTGGTGAGAAGGTGG + Intronic
950585126 3:13886864-13886886 AAGAAGGAGAGGTGGGAAGGAGG + Intergenic
950811784 3:15656248-15656270 GATTAGAACTGATGGGAAGGGGG - Intergenic
950982825 3:17327455-17327477 GAGCAGGACTGTAGGAAATGAGG - Intronic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
952003254 3:28810294-28810316 GAGCAGGGCTGGAGGGAACTGGG + Intergenic
952926585 3:38325146-38325168 GAACAGGTCTGCTGGGCAGGGGG - Intergenic
953375866 3:42428181-42428203 GGGCAGGACTGATGGGCAGATGG - Intergenic
953411320 3:42691944-42691966 GAGCCGCACTGGTAGGAAGGTGG - Exonic
953535394 3:43773443-43773465 GACCAGCCCTGGTGGCAAGGAGG + Intergenic
953535794 3:43775727-43775749 CAGCTGGCCTGGTGGGGAGGTGG + Intergenic
953806087 3:46068500-46068522 GAGCAGTGATGGTGGGAAGTTGG + Intergenic
953926023 3:46982805-46982827 AAGCAGGCCTGGTGGACAGGTGG + Intronic
954146909 3:48639013-48639035 GAGAGGGACTGGTGGGAGTGGGG - Intronic
954328944 3:49878844-49878866 GCTCAGATCTGGTGGGAAGGAGG - Intergenic
954366853 3:50151031-50151053 GAGGGGGAGTGTTGGGAAGGGGG - Intergenic
954384789 3:50238364-50238386 GAGCAGGCCTGGTGGGATGGGGG - Intronic
954709737 3:52499540-52499562 GGGCAGGTGTGGTGGGAAAGAGG - Intronic
955472697 3:59302501-59302523 GAGTAGAACTGGGGGGATGGGGG - Intergenic
955965565 3:64385577-64385599 GAGGAGGCCTCATGGGAAGGGGG - Intronic
956588622 3:70889570-70889592 GAGCAGGAGTGGGGGTATGGGGG + Intergenic
957528454 3:81408424-81408446 GAGCCAGACGGGTGAGAAGGGGG + Intergenic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
959010978 3:101075961-101075983 GAGTTGGACGGGTGGGAGGGTGG + Intergenic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960562782 3:119103747-119103769 AAGCAGGATTGGTAGGAATGAGG - Intronic
960997059 3:123347329-123347351 CAGGAGGACTGGTGATAAGGTGG + Intronic
961584162 3:127908492-127908514 GAGCAATACTTTTGGGAAGGTGG + Intergenic
961860763 3:129915555-129915577 GGGCAGGACAGGTGTGAAGTCGG - Intergenic
962518995 3:136180735-136180757 GAGGAGGAGAGGAGGGAAGGAGG + Intronic
963230464 3:142904413-142904435 GAGCAGGAGAGGAGAGAAGGAGG + Intergenic
963509619 3:146230631-146230653 GAGCAGAAGAGGTGGGAAAGTGG + Intronic
964846489 3:161049799-161049821 GGGCAGGGCTGGTGAGGAGGAGG - Intronic
964892939 3:161558260-161558282 GAGCAGGAGGTGTGGGAAGGGGG - Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
967092424 3:186146480-186146502 GAGCGGGAGTTGGGGGAAGGAGG - Intronic
967104197 3:186242262-186242284 GGGCAGGGCTGGAGGGCAGGAGG - Intronic
967327614 3:188257910-188257932 TAGCAGCACTGGGTGGAAGGTGG - Intronic
968120326 3:196121449-196121471 GTGTAGGTCTGGTGGGTAGGGGG - Intergenic
968504231 4:964569-964591 GGGCAGGGCTGGGGGAAAGGGGG - Intronic
968653809 4:1770233-1770255 GAGGAGGGCTGGTGAGGAGGGGG + Intergenic
968750225 4:2385077-2385099 GCCCAGGACTGGCGAGAAGGGGG + Intronic
969057289 4:4409849-4409871 GAGCAGGGCAGGTAGGCAGGGGG + Intronic
969069486 4:4523719-4523741 GAGAAGGACTGGCAGCAAGGAGG - Intronic
969330905 4:6472886-6472908 GAGCCGGGGTGCTGGGAAGGGGG + Intronic
969443615 4:7232139-7232161 GAGCAGGATTGGGGGAATGGAGG + Intronic
969627672 4:8316071-8316093 GGGCTGAACTGGAGGGAAGGCGG - Intergenic
970249021 4:14094491-14094513 TAGGAGGGCTGGTGGGAAAGGGG - Intergenic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
973317741 4:48779694-48779716 GAGCAGGACGCGCGAGAAGGCGG + Intronic
974548955 4:63348632-63348654 GAGCTGGGCTGGGGGGATGGGGG + Intergenic
975827297 4:78333268-78333290 AAACAGGACTGGTGGCAAGCTGG - Exonic
976561957 4:86511842-86511864 GAGCAGGAATGAAGGAAAGGAGG + Intronic
977466188 4:97384661-97384683 GAGCCGGACTGATGGAAGGGTGG + Intronic
978381761 4:108135894-108135916 GGGCAGGATTGGGGGAAAGGGGG - Intronic
978385665 4:108173227-108173249 GCGGAGGGCCGGTGGGAAGGAGG - Intergenic
979618897 4:122776092-122776114 GAAGAGGGCTGGTAGGAAGGAGG + Intergenic
980129160 4:128802846-128802868 GAGCTGGCTTGGTGGGGAGGCGG - Intergenic
981113412 4:140960818-140960840 GCGCAGGTGTGGGGGGAAGGTGG + Intronic
981835708 4:149050968-149050990 GAGCAGGACCTCAGGGAAGGAGG - Intergenic
982670417 4:158313945-158313967 CAGAAGGGCTGGTGGGCAGGTGG + Intergenic
983273659 4:165592084-165592106 GAGAAGGAATGGAGGGATGGAGG - Intergenic
983644532 4:169976562-169976584 GTGCAGGTGTGGTGGGAAGGGGG + Intergenic
984537105 4:180989974-180989996 GAGCAGAATTGGGCGGAAGGAGG - Intergenic
984933621 4:184870297-184870319 AAGCAGGATTCCTGGGAAGGAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985275129 4:188230968-188230990 GTGCAGCACAGGTGGAAAGGTGG + Intergenic
985294822 4:188425500-188425522 GAGCAGGATGGGGAGGAAGGAGG - Intergenic
986234217 5:5892663-5892685 GAGAAGGACTGCTGGGGAGTCGG + Intergenic
986305976 5:6517231-6517253 GAGGAGGAGGCGTGGGAAGGTGG + Intergenic
986871306 5:12049860-12049882 GAGAAGGACTGGTGGGGGGTTGG + Intergenic
986967983 5:13298542-13298564 GTGCAGGGCTGGTAGGGAGGTGG + Intergenic
988854927 5:35219126-35219148 GAGTTGGACTGGTGGGGAGATGG - Intronic
989043161 5:37249461-37249483 GAGCAGGGCTGGAGGGGCGGAGG - Intergenic
990886668 5:60602144-60602166 AAGCAGGGAAGGTGGGAAGGAGG + Intronic
991329964 5:65483214-65483236 GAACTGGACCGGAGGGAAGGGGG + Intergenic
993607186 5:90006208-90006230 AGGAAGGAGTGGTGGGAAGGTGG + Intergenic
997713892 5:136028463-136028485 GAGCATGACAGGTGGGGTGGGGG + Intergenic
997834126 5:137178674-137178696 GTGCAGGACTGGTGTGAGGGTGG - Intronic
998136307 5:139676321-139676343 GAGAAGGACTGGGGAGGAGGTGG - Intronic
998400078 5:141844135-141844157 CAGCAGAACAGGTGGGAATGAGG - Intergenic
998405780 5:141874089-141874111 GTCCAGGAATGGTGGGGAGGCGG - Intronic
998914096 5:146995589-146995611 GAGTTGAACTTGTGGGAAGGTGG - Intronic
999494434 5:152083267-152083289 GAGCTGGTTTGGTGGGAAGAAGG + Intergenic
999773469 5:154792809-154792831 GAGCAGGACTTGGGAGAAGGTGG + Intronic
1000777036 5:165432748-165432770 GAGGATGGCAGGTGGGAAGGAGG + Intergenic
1001149519 5:169214982-169215004 GAGCGAGACTGGAGGCAAGGAGG - Intronic
1001891712 5:175344780-175344802 AGGCAGGAGTGGGGGGAAGGAGG + Intergenic
1002097159 5:176838205-176838227 GAGCTGGAGAGGTGGGAAGTAGG + Intronic
1002105233 5:176876708-176876730 GAGCAGGACGGGAGGGCAGTGGG + Intronic
1002400799 5:178990754-178990776 GAGCAGGGCTGGGGTGAGGGAGG + Intronic
1002500648 5:179645192-179645214 GAGCAGGTGGAGTGGGAAGGAGG - Intergenic
1002885377 6:1289335-1289357 AAGCAGGACAGGTGCCAAGGGGG + Intergenic
1002940100 6:1708356-1708378 GATGAGGAGTGGAGGGAAGGCGG + Intronic
1003108187 6:3231334-3231356 GGGAAGGCCTGGGGGGAAGGGGG - Intronic
1003459264 6:6314957-6314979 GACAAGGAGTGGTGGGATGGAGG + Intronic
1004301909 6:14466234-14466256 GGGAAGGACTGGTAGGTAGGAGG + Intergenic
1004345710 6:14847301-14847323 TACCAGGACTGGTGGTACGGCGG + Intergenic
1004957041 6:20739007-20739029 GAGCAGGACTGAGGAGATGGGGG + Intronic
1005024707 6:21451435-21451457 GAGAAGGACTGGTGGTAAAGAGG - Intergenic
1006172860 6:32105108-32105130 GAGCTGGAATGGAGGGAGGGAGG - Intronic
1006333942 6:33410932-33410954 GGGGAGGACTGGGGGAAAGGAGG - Intronic
1006362119 6:33592528-33592550 GAGCAGGACTGGTGGGTTTGAGG + Intergenic
1007200938 6:40108686-40108708 GAGCAGCACTGGTAGGAGGCAGG + Intergenic
1007394607 6:41570399-41570421 GAGAAGGACAGGTGGGAGGTGGG + Intronic
1007656090 6:43451852-43451874 AGGCAGGACTGTTGGGAGGGTGG - Intronic
1010331635 6:74629971-74629993 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1011525957 6:88265238-88265260 CAGCATGACTGGTGGGATGAAGG + Intergenic
1011547846 6:88500418-88500440 GAGCAGAACCTGTGTGAAGGAGG + Intergenic
1011737872 6:90330979-90331001 GAGCGGGCTTGGTGGGGAGGAGG + Intergenic
1012359404 6:98358662-98358684 CAGCAAGGATGGTGGGAAGGAGG + Intergenic
1012975796 6:105779782-105779804 GAGCAGGACTGGCAGGGAGGTGG + Intergenic
1013275692 6:108582840-108582862 AAGCAGGGCTGCTGAGAAGGGGG - Intronic
1013314556 6:108929132-108929154 GATCAGATCTGGAGGGAAGGAGG - Intronic
1015129384 6:129792737-129792759 GAGGAGGACAGATGAGAAGGAGG + Intergenic
1015454124 6:133405776-133405798 GAGAATGAATGGGGGGAAGGGGG + Intronic
1016003884 6:139069803-139069825 GAGAATGACTTTTGGGAAGGTGG + Intergenic
1016126909 6:140414933-140414955 GAGAAGGACTGGGGAGAAGGAGG - Intergenic
1016882760 6:148927209-148927231 GAGGAGGACCAGTGGGAGGGAGG + Intronic
1017033985 6:150250841-150250863 GATCAGGGCAGGAGGGAAGGTGG - Intergenic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017773977 6:157665460-157665482 GAGAAAGGCTGGTGGGAAAGAGG + Intronic
1017781888 6:157721756-157721778 GAGCAGGACGGGCGGGAAGGAGG - Intronic
1017989689 6:159475394-159475416 GAGCAGAACTGGGAGGAAGTTGG - Intergenic
1017993627 6:159511386-159511408 GAGCAGGGCTGCTGGGGAGCTGG + Intergenic
1018176843 6:161184571-161184593 GAGGATGACAGGTGGGAATGGGG - Intronic
1018216571 6:161533980-161534002 GAGGAGGACAGGTGGAAAGGGGG - Intronic
1018910870 6:168100408-168100430 GAGCAGGGGTGGTGGGGAAGGGG - Intergenic
1019059185 6:169243100-169243122 AGGTAGGAGTGGTGGGAAGGTGG - Intronic
1019279435 7:192671-192693 GACCGGGGCTGGGGGGAAGGGGG - Intergenic
1019619229 7:1981563-1981585 GGTCAGGACTGGTGGGAACAAGG - Intronic
1019885339 7:3899617-3899639 GAGCAGGCCTGGGAGGGAGGAGG - Intronic
1019935038 7:4249308-4249330 GAGCAGGACTGGTGGGAAGGTGG - Intronic
1019999103 7:4744780-4744802 GAACAGGACTGGGCGGAAGGAGG - Intronic
1020240395 7:6390007-6390029 GAGTAGGAGAGGAGGGAAGGAGG - Intronic
1021605195 7:22402966-22402988 GAGCAGGCCTGGGGTGAAGGAGG - Intergenic
1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG + Intronic
1023055169 7:36285047-36285069 GAGCAGGAGAGGGGGGAAGGAGG + Intronic
1023575497 7:41622064-41622086 GAGAAGGAATGGAGGGAGGGAGG + Intergenic
1023699373 7:42877616-42877638 GAGGGGGACTGGTGGGCAGAGGG - Intergenic
1023839628 7:44089058-44089080 GAGCAGGCCCAGAGGGAAGGAGG - Intergenic
1023989489 7:45119587-45119609 GACCAGGATTGGTGGGAGAGGGG - Intergenic
1025837899 7:65112896-65112918 GAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1025879370 7:65520187-65520209 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1025885169 7:65583088-65583110 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1027119102 7:75502994-75503016 GAGCAGGGGTGGGGGGAGGGGGG + Intergenic
1027272726 7:76532611-76532633 GAGCAGGGGTGGGGGGAGGGGGG - Intergenic
1027326174 7:77051696-77051718 GAGCAGGGGTGGGGGGAGGGGGG - Intergenic
1027969912 7:85066303-85066325 GAGAAGGGATGGTGAGAAGGAGG + Intronic
1028932036 7:96423988-96424010 AAGCAGGGCTGGAGGAAAGGAGG - Intergenic
1029252569 7:99247579-99247601 GAGTAGGTCTGGTGGGAGGGAGG - Intergenic
1029403939 7:100362057-100362079 GAGCAGGAATGGAGAGCAGGGGG + Intronic
1029718396 7:102347038-102347060 GAGCAGGGGTGGGGGGAGGGGGG - Intergenic
1029754220 7:102562217-102562239 GAGCAGGGGTGGGGGGAGGGGGG + Intronic
1029772170 7:102661307-102661329 GAGCAGGGGTGGGGGGAGGGGGG + Intronic
1029793703 7:102871915-102871937 GAGAAGGACTGGGGGCAGGGAGG - Intronic
1029813800 7:103074572-103074594 GGGGAGGAGTGGAGGGAAGGCGG - Intronic
1029986943 7:104931147-104931169 GCACAGGACTGCTGAGAAGGGGG + Intergenic
1030109567 7:106015303-106015325 GGGCAGTACTAGTGAGAAGGGGG - Intronic
1031871216 7:127091591-127091613 GAGCATGACGAGTGGGATGGGGG - Intronic
1032870165 7:135976936-135976958 GAGCTGGACTGCGGGGATGGGGG - Intronic
1033041994 7:137927376-137927398 GAGAAGGAAGGGAGGGAAGGAGG + Intronic
1033742284 7:144284479-144284501 GAGCAGAAATGGGAGGAAGGTGG + Intergenic
1033751618 7:144365135-144365157 GAGCAGAAATGGGAGGAAGGTGG - Exonic
1034927925 7:155138206-155138228 AAGCAGGACTGGGCAGAAGGAGG + Intergenic
1035458941 7:159027516-159027538 GAGCAAAGCAGGTGGGAAGGGGG - Intergenic
1035553099 8:544915-544937 GGGCGGGCCTGGTGGGGAGGGGG - Intronic
1035573150 8:687586-687608 GAGCAGGACTGGAGGGAGGCGGG + Intronic
1036384886 8:8270289-8270311 GAGAAGGCCTGCTGGGAAAGGGG + Intergenic
1036730528 8:11259035-11259057 GAGCAGGAGTGAGGGGTAGGAGG - Intergenic
1036962834 8:13264584-13264606 GAGCGGGAGAGGAGGGAAGGAGG + Intronic
1037897924 8:22670437-22670459 GAGCAGGAGAGGTAGGAGGGTGG + Intergenic
1038625679 8:29190680-29190702 GACCTGCGCTGGTGGGAAGGAGG + Intronic
1039482543 8:37885372-37885394 GATCAGGAGGGGTGGGAAGATGG - Intronic
1041935128 8:63324895-63324917 AAGCAGGTCTGGGGGGAAGCTGG - Intergenic
1042230024 8:66545711-66545733 GAGGAGGGATGGAGGGAAGGAGG + Intergenic
1043045062 8:75312781-75312803 GAGAAGGAATGGAAGGAAGGAGG + Intergenic
1046646429 8:116791117-116791139 GCACATCACTGGTGGGAAGGAGG - Intronic
1046739413 8:117812544-117812566 GCGCAGAACTGAGGGGAAGGGGG - Intronic
1047756903 8:127926084-127926106 GACCATGACTGGAGGGAAGTGGG - Intergenic
1048432449 8:134382739-134382761 GAGAAGGACTGGTAGGTAGGAGG - Intergenic
1048550784 8:135432162-135432184 GAGCAGGGATGGCAGGAAGGAGG - Intergenic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1049093841 8:140536208-140536230 GAGCAGGGCTTGTGGGGTGGGGG - Intronic
1049469797 8:142770203-142770225 AGGAAGGTCTGGTGGGAAGGAGG + Intronic
1050188596 9:3001187-3001209 GAGCAGGACTGTCTGGGAGGAGG + Intergenic
1050694426 9:8262764-8262786 TAGCAGGAGTGCTGGCAAGGTGG + Intergenic
1051544660 9:18260527-18260549 GAGCCTGACTGGTGGGAGGATGG - Intergenic
1052739778 9:32382333-32382355 TAGCAGGTGTGGTGGGAAGAGGG + Intergenic
1052972373 9:34384980-34385002 GAGCAGGATGGCTGGGAAGATGG + Intronic
1053072692 9:35110557-35110579 GGGCAGGACTGCAGGGGAGGGGG + Exonic
1053273733 9:36767686-36767708 GAGAAGGAGTGGAGGGAGGGGGG + Intergenic
1054962177 9:70981121-70981143 GAGCAGGTCTGTGGGGATGGGGG - Intronic
1055226514 9:74003919-74003941 GGGCAAAACTGGTGGGAAGGAGG + Intergenic
1055316734 9:75041530-75041552 GAGCAGGCCTGTGGGGCAGGAGG - Intergenic
1056597200 9:88017260-88017282 GAGGAGGAGTGTTGGGAAAGAGG - Intergenic
1056671114 9:88627588-88627610 AAGGAGGATTGGGGGGAAGGTGG + Intergenic
1056726399 9:89122805-89122827 GAGTAGGAATTGTGGGAAGGAGG + Intronic
1057769478 9:97954855-97954877 GAGGAGGACTTGGAGGAAGGGGG - Intergenic
1059311342 9:113390767-113390789 CAGCAGGGCTGGTGGGAGGGAGG + Intronic
1059421455 9:114195035-114195057 GTGCAGGACAGATGGGAAGAGGG + Intronic
1059709578 9:116855247-116855269 GAGCAGGCTGGGTGGGTAGGTGG - Intronic
1059774346 9:117460704-117460726 GAGGAGGAGGGGTGGGAAAGAGG + Intergenic
1059837525 9:118172550-118172572 GAGGAGGACAAGTGGGAATGAGG - Intergenic
1060190369 9:121588654-121588676 GAGCAGGACTGGGCAGGAGGAGG + Intronic
1060190595 9:121589896-121589918 GAGCAGGACTGGGCAGAAGGAGG - Intronic
1060230281 9:121820781-121820803 AGGCAGGACAGGTGGGAAGGTGG - Intergenic
1060603872 9:124896985-124897007 GAGCATGGCTGGTGGTGAGGCGG - Intronic
1060815093 9:126631016-126631038 GAGCTGGAGGGGTGGGCAGGCGG - Intronic
1061187180 9:129061349-129061371 GAGCAGGTGTGGAGGGAGGGAGG + Intronic
1061403428 9:130381019-130381041 GGGCAGGACTGGGGGGCAGTTGG - Intronic
1061995681 9:134181587-134181609 CAGCAGGACCCGTGGGCAGGTGG - Intergenic
1062043528 9:134414998-134415020 GAGCAGGGCTGGTGGGCAAATGG - Intronic
1062081913 9:134628618-134628640 GAGGAGGGCTGGTGTGAAGAAGG - Intergenic
1062216396 9:135392032-135392054 GGGCAGGAGAGGTGGGGAGGAGG - Intergenic
1062449180 9:136608364-136608386 GAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1062624013 9:137434903-137434925 TTGCAGGACTAGTGGGAAGGCGG - Exonic
1185464488 X:346478-346500 GCCCAGGACAGGTGGGAAGGGGG + Intronic
1185509313 X:651036-651058 GTGCAGGTCCCGTGGGAAGGAGG + Intronic
1185603592 X:1354959-1354981 GAGGAGGACTGGGGGGAGGAAGG + Intronic
1187389402 X:18875909-18875931 CAGGAGGAGTGGTGGAAAGGAGG + Intergenic
1188684663 X:33054941-33054963 GAGCATAACTGATGGGCAGGGGG + Intronic
1189318703 X:40074295-40074317 CAGCAGGCTGGGTGGGAAGGTGG + Exonic
1189410487 X:40766110-40766132 GAGCAGGAGTGGTGGTGGGGAGG - Intergenic
1190245384 X:48687338-48687360 GAGAAGGGCTGGTGGGTAGGTGG + Intronic
1190304982 X:49076743-49076765 GATCAGCACTGCTGGGCAGGTGG + Exonic
1190439475 X:50463196-50463218 GAGAAGGAGGGGTGGGAAAGAGG - Intronic
1191929970 X:66361208-66361230 GGGCAAGACTGGTGGAGAGGTGG + Intergenic
1192190063 X:68985574-68985596 GAGAAGGACAGGGGGGAAGGGGG + Intergenic
1192208147 X:69109668-69109690 GAGCAGGACTGAGGGCAAAGTGG - Intergenic
1193636846 X:83961449-83961471 CAGCAGGAAGGGTGGGAGGGGGG + Intergenic
1193820871 X:86163177-86163199 GTGAAGGGCTGGAGGGAAGGTGG - Intronic
1197530351 X:127616623-127616645 AAGCAGAACTGGTGGGCAGGTGG - Intergenic
1198138750 X:133781652-133781674 AAGCATGCCTAGTGGGAAGGTGG + Intronic
1198609027 X:138376483-138376505 GAGAAGGACCAGTGGGAAGCTGG - Intergenic
1198963818 X:142207629-142207651 GGGCAGGAGTGGGTGGAAGGGGG - Intergenic
1199019118 X:142854750-142854772 GCACAGGACTGGTTGGAAGCAGG + Intergenic
1199288649 X:146082062-146082084 GAGCTGGACTGGTTGGATGTAGG - Intergenic
1200153646 X:153963907-153963929 GAGCAGGCCTCGTGGGAGGAGGG - Intronic