ID: 1019935739

View in Genome Browser
Species Human (GRCh38)
Location 7:4256299-4256321
Sequence TCTGGAATGGCAATGTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 265}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019935739_1019935748 20 Left 1019935739 7:4256299-4256321 CCTCCTCACATTGCCATTCCAGA 0: 1
1: 0
2: 1
3: 31
4: 265
Right 1019935748 7:4256342-4256364 TAGTAACTCTGATATTCAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1019935739_1019935747 19 Left 1019935739 7:4256299-4256321 CCTCCTCACATTGCCATTCCAGA 0: 1
1: 0
2: 1
3: 31
4: 265
Right 1019935747 7:4256341-4256363 CTAGTAACTCTGATATTCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 127
1019935739_1019935744 -4 Left 1019935739 7:4256299-4256321 CCTCCTCACATTGCCATTCCAGA 0: 1
1: 0
2: 1
3: 31
4: 265
Right 1019935744 7:4256318-4256340 CAGAAATATCCTGGCCTTCATGG 0: 1
1: 0
2: 2
3: 21
4: 288
1019935739_1019935751 27 Left 1019935739 7:4256299-4256321 CCTCCTCACATTGCCATTCCAGA 0: 1
1: 0
2: 1
3: 31
4: 265
Right 1019935751 7:4256349-4256371 TCTGATATTCAGAGGGGACTGGG No data
1019935739_1019935750 26 Left 1019935739 7:4256299-4256321 CCTCCTCACATTGCCATTCCAGA 0: 1
1: 0
2: 1
3: 31
4: 265
Right 1019935750 7:4256348-4256370 CTCTGATATTCAGAGGGGACTGG No data
1019935739_1019935749 21 Left 1019935739 7:4256299-4256321 CCTCCTCACATTGCCATTCCAGA 0: 1
1: 0
2: 1
3: 31
4: 265
Right 1019935749 7:4256343-4256365 AGTAACTCTGATATTCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019935739 Original CRISPR TCTGGAATGGCAATGTGAGG AGG (reversed) Intronic
902777792 1:18685701-18685723 TATGGGATGGCAAGGTGAGTGGG + Intronic
903298446 1:22360991-22361013 TTTGGAATGGAAAAGTGAGCAGG + Intergenic
903718299 1:25385707-25385729 TCTGGAACGGCAATGGCATGTGG - Exonic
904081840 1:27877119-27877141 TCTGGGATGACAGTGAGAGGAGG + Intronic
904394136 1:30206671-30206693 TATGGAATGGAAATGGGAGTGGG - Intergenic
906190661 1:43897700-43897722 TCAGGATTGGCAATGTGAGAGGG + Intronic
906556085 1:46715568-46715590 TCTCAAATGGCCCTGTGAGGTGG + Intronic
906655154 1:47542827-47542849 TGTGGAAGGGAAATGTGGGGTGG + Intergenic
907394501 1:54179776-54179798 GCTGGAATGGCATTGGGAGTGGG - Intronic
910877999 1:91895606-91895628 TCTGGACTGGCCGTGTGTGGTGG - Intronic
911007598 1:93243112-93243134 TGTGGAAGGGAAATGTGGGGTGG - Intronic
912907359 1:113720774-113720796 TGTGGAAGGGAAATGTGGGGTGG - Intronic
916123838 1:161551686-161551708 TTTGGAAGGCCAATGTGAGGTGG + Intergenic
916133722 1:161633049-161633071 TTTGGAAGGCCAATGTGAGGTGG + Intronic
917514213 1:175693581-175693603 TCAGGAATGGCCAGGAGAGGAGG - Intronic
917920455 1:179745266-179745288 TCTGGAAAGGCAAGGTGAGATGG + Intronic
918558895 1:185840433-185840455 TCATGAATGGCATTTTGAGGAGG + Intronic
918886211 1:190197887-190197909 TGTGGAAGGGAAATGTGGGGTGG - Intronic
919247468 1:195006656-195006678 TCTGGAATGTCTGTGTGTGGGGG - Intergenic
919838077 1:201590342-201590364 TTTGGAATGGAACTGAGAGGCGG - Intergenic
921996563 1:221425879-221425901 TGTGGAAGGGAAATGTGAGGTGG - Intergenic
923207821 1:231775900-231775922 TCTGTAATGGGATTGTGATGTGG + Intronic
924181291 1:241440875-241440897 TATAGAATGGCACTGTGTGGTGG + Intergenic
924608511 1:245555212-245555234 TCTGGAATGGGGATGGGAGGAGG + Intronic
1064920419 10:20510941-20510963 TCTGGCATAGCAATTTGAGAGGG - Intergenic
1065185231 10:23164587-23164609 TCTGGGATTGCAATGTGCAGCGG + Intergenic
1066619957 10:37337505-37337527 TCTGTAATGGCAGTTTGAGGTGG + Intronic
1067482841 10:46615951-46615973 TTTGGGATGCCAAGGTGAGGAGG + Intergenic
1067611913 10:47725714-47725736 TTTGGGATGCCAAGGTGAGGAGG - Intergenic
1067966893 10:50923353-50923375 TGTGGAATGGAAATATGGGGTGG - Intergenic
1068235818 10:54231474-54231496 TGTGGAAGGGAAATGTGAGGTGG + Intronic
1069861915 10:71476839-71476861 TCTGGAAGAGCCATGAGAGGAGG - Intronic
1070130015 10:73649208-73649230 TCCTGACTGGCAATGGGAGGGGG + Intronic
1070554739 10:77518785-77518807 TCTTTGATGGCAAAGTGAGGAGG - Intronic
1071433708 10:85626870-85626892 TCTGGAATGGCAATTTGGTGGGG + Intronic
1071627331 10:87185949-87185971 TTTGGGATGCCAAGGTGAGGAGG - Intronic
1071873751 10:89821582-89821604 TCTTAAATGGCACTGTGAGGAGG + Intergenic
1072674669 10:97456874-97456896 TCTGTGATGGCAGTGTGAGCTGG + Exonic
1073070181 10:100788370-100788392 TCTGGAGGGGCAGTGGGAGGAGG + Intronic
1073320332 10:102612588-102612610 TCATGAATAGCAATGGGAGGTGG - Intronic
1074286234 10:112100647-112100669 TGTGGAAGGGAAATGTGGGGTGG - Intergenic
1078167059 11:8896487-8896509 TCCAGAATGGCATAGTGAGGAGG + Intronic
1078174109 11:8955879-8955901 GCTGGAAAGGCAAGGAGAGGAGG + Intronic
1079652098 11:22942545-22942567 TGTGGAAGGGAAATGTGGGGTGG - Intergenic
1080306327 11:30840430-30840452 CATGGAAGGGCAATGTGATGAGG + Intronic
1080982370 11:37423877-37423899 CGTGGAAAGGAAATGTGAGGTGG - Intergenic
1081083985 11:38776200-38776222 TCTTGAATTCCAATGTGATGTGG - Intergenic
1081324600 11:41729025-41729047 TCTGAGATGGAACTGTGAGGTGG - Intergenic
1082626772 11:55496164-55496186 TGTGGAATGGAAATATGAGGTGG - Intergenic
1084484911 11:69442642-69442664 CCTCGAATGCCAAAGTGAGGAGG - Intergenic
1084581966 11:70029729-70029751 TCTGGAATGAGAGTGTGAGCAGG + Intergenic
1087234847 11:95706533-95706555 TCTGGAGAAGCACTGTGAGGTGG + Intergenic
1087489707 11:98809459-98809481 TATGAAATGGTAAGGTGAGGTGG + Intergenic
1088072206 11:105801968-105801990 TCTGGGATGCCAATTTGAGCAGG + Intronic
1090064255 11:123489581-123489603 TCTGCAGTGGCAATTTGTGGAGG + Intergenic
1090580507 11:128153812-128153834 TCTGGAATGTCAAAGAGAGGAGG + Intergenic
1095724920 12:45441225-45441247 TCTGGCATGGCATTGTTGGGAGG + Intergenic
1097141996 12:56909620-56909642 TGTGGAAGGGAAATGTGGGGTGG + Intergenic
1098944383 12:76573712-76573734 TGTGGAAGGGAAATGTGGGGTGG - Intergenic
1101335239 12:103791019-103791041 TTTGGAATAGCCATGTGAGGGGG - Intronic
1101618614 12:106361884-106361906 TGTGGAAAGGGAATGTGAGGGGG + Intronic
1101743606 12:107521123-107521145 TCTTTAATGGAAAAGTGAGGAGG + Intronic
1102644204 12:114393337-114393359 TCTGGAAGGGCAAAGTGGGAGGG - Intronic
1103975607 12:124700836-124700858 TCTGGAGTGACCATGTGTGGTGG + Intergenic
1105694154 13:22871721-22871743 TGTGGAAGGGAAATGTGGGGTGG + Intergenic
1106338612 13:28807216-28807238 TCTGGAATGGAAAATAGAGGAGG + Intergenic
1108792891 13:53994482-53994504 TCTGGTCTGGCCATGTGAAGTGG - Intergenic
1109109073 13:58292910-58292932 TGTGGAAGGGAAATGTGTGGTGG + Intergenic
1109171943 13:59107756-59107778 TGTGGAAGGGAAATGTGGGGTGG + Intergenic
1111609526 13:90584941-90584963 TGTGGAAGGGAAATGTGGGGTGG - Intergenic
1112104273 13:96223640-96223662 TCTGGAATGGATATGGGGGGGGG + Intronic
1114320992 14:21547041-21547063 TGTGGAAGGGAAATGTGGGGTGG - Intergenic
1115422235 14:33209341-33209363 TATGTAATGTCAATGTGGGGTGG + Intronic
1119251228 14:73156521-73156543 ACTGGAGTGGCAAAGTGAGCGGG + Intronic
1119880679 14:78097164-78097186 TGTGGAAGGGAAATGTGGGGTGG - Intergenic
1120599020 14:86477664-86477686 TCTGGTATGGAAATGATAGGAGG - Intergenic
1120695450 14:87639401-87639423 TCTGGCCTGGCAAGGTTAGGTGG - Intergenic
1122852325 14:104543294-104543316 CCTGGGATGACAAGGTGAGGCGG - Intronic
1123478748 15:20612175-20612197 TGTGGAAAGGGAATGTCAGGCGG + Intergenic
1123639265 15:22388210-22388232 TGTGGAAAGGGAATGTCAGGCGG - Intergenic
1123795632 15:23767287-23767309 TATGGAAGGGAAATGTGGGGTGG + Intergenic
1124132819 15:27004864-27004886 TGTGGACTGGCATTGTGAGCGGG + Intronic
1124407732 15:29406832-29406854 TTTGGATTGGGAAAGTGAGGAGG - Intronic
1126202474 15:46002824-46002846 TGTAGGATGGGAATGTGAGGGGG - Intergenic
1126474493 15:49051688-49051710 TGTGGAAGGGAAATGTGGGGCGG - Intergenic
1126864433 15:52921698-52921720 TCTGGAATAGGAATGGGAGCTGG + Intergenic
1128147581 15:65340477-65340499 TCTTGAATGGCTGTATGAGGTGG - Intronic
1128477119 15:68006685-68006707 TTTGGAATGGGAATGTGTTGCGG + Intergenic
1128733091 15:70034088-70034110 TCTGGAATGGGGCTGTGGGGAGG + Intergenic
1128976849 15:72160666-72160688 TCTGGAAGGGCTTAGTGAGGAGG - Exonic
1129099753 15:73249284-73249306 GCTTGACTGGAAATGTGAGGGGG + Intronic
1130724904 15:86429084-86429106 TTTGGAATGTCTTTGTGAGGAGG - Intronic
1131191958 15:90324056-90324078 TCTGGGAGGCCAAGGTGAGGTGG + Intergenic
1132121999 15:99184195-99184217 TGTGGAAAGGAAATGTGGGGTGG + Intronic
1132389976 15:101431488-101431510 TCTGGAATGTCCATGTCGGGGGG - Intronic
1132831538 16:1930526-1930548 CCTGGACTCTCAATGTGAGGGGG + Intergenic
1134312898 16:13092555-13092577 TCTGAGATCGAAATGTGAGGTGG - Intronic
1134797355 16:17053788-17053810 TCTGCCATGGCAAAGGGAGGTGG + Intergenic
1135156287 16:20055665-20055687 TCTGAAATGGAGATGTGGGGTGG - Intronic
1137369721 16:47894039-47894061 TCTGGGAGGCCAATGTGGGGTGG + Intergenic
1137399926 16:48145055-48145077 TGTGGAGAGGCAATGTGGGGAGG - Intronic
1137559639 16:49494444-49494466 TCTGCACTGGCACAGTGAGGGGG + Intronic
1139249870 16:65484980-65485002 TCAGCAATGGCAATTGGAGGAGG + Intergenic
1140749695 16:78012049-78012071 GCTGGAATGGCTGTGTGGGGTGG - Intergenic
1141899260 16:86979710-86979732 TCTGGAAAGGCAGTGGGAGGGGG + Intergenic
1142660143 17:1423283-1423305 TCTGAATTGGCAATTGGAGGCGG - Exonic
1143977416 17:10840173-10840195 ACTGGACTGGCCAGGTGAGGGGG - Intergenic
1146730141 17:35186200-35186222 CCTGGTGTGGCAATGTTAGGAGG - Intronic
1147382940 17:40066177-40066199 TCTGGAGAGGGAATTTGAGGAGG + Intronic
1148190072 17:45672197-45672219 CCTGGAATGGCAATGGTGGGAGG + Intergenic
1148410850 17:47465750-47465772 TCTGGAATGCCAAAGAGAAGAGG + Intergenic
1152176301 17:78789856-78789878 TCAGGGAAGGCAATGTGAAGGGG + Intronic
1152281029 17:79384985-79385007 CCTGGAAGGGCAATCTGATGAGG - Intronic
1152289227 17:79429390-79429412 TGGGGACTGGCAATGTGGGGTGG + Intronic
1155114967 18:22754928-22754950 TCTGTAAGGGCAATGGGAGGTGG - Intergenic
1155153834 18:23142327-23142349 GCTGGACTGACAATGTTAGGAGG + Intronic
1155181359 18:23351028-23351050 TCTGGCATGACAGAGTGAGGAGG - Intronic
1155679686 18:28474276-28474298 TGTGGAAGGGAAATGTGGGGTGG + Intergenic
1156183898 18:34639192-34639214 CCTGAAATGTCAATGTGAAGAGG - Intronic
1156337622 18:36185266-36185288 TCACGAATGGCACTCTGAGGAGG - Intergenic
1156620202 18:38842675-38842697 TAGGGAATGGCAAGTTGAGGTGG - Intergenic
1157035400 18:43966754-43966776 TTTTGAATGGCATTGTAAGGTGG - Intergenic
1163059130 19:14745557-14745579 TCTGGAAAGGGTATGTGAGTGGG - Intronic
1164494789 19:28749997-28750019 TATGGAAGGGAAATGTGGGGTGG - Intergenic
1165234228 19:34407424-34407446 TCTGGAGTGGCCAGGTGTGGTGG - Intronic
1165560345 19:36673990-36674012 TCAGGAATGGCTTTGTGAAGCGG - Intergenic
1165639845 19:37375099-37375121 GCTGGAAAGACAATGTGAAGTGG + Intronic
1166257323 19:41615731-41615753 TCAGGTGTGGGAATGTGAGGTGG + Intronic
1166310117 19:41958074-41958096 TGAGGAATAGCAATTTGAGGGGG + Intronic
1166964107 19:46517518-46517540 CCAGGAATGGCAAAGTGAGGTGG + Intronic
1167483838 19:49748575-49748597 CCTGGAATGGCTATGTGACTTGG + Intronic
927960167 2:27236292-27236314 TGTGGACTGGCACTTTGAGGAGG + Exonic
928450595 2:31374932-31374954 GGTGGAATGGGAATGTCAGGTGG - Intronic
930720059 2:54629870-54629892 TCTGAAATGGCAATTTGACAGGG - Exonic
933812678 2:86042813-86042835 TCTCAAATGGGAATGTAAGGTGG - Intronic
934482433 2:94663927-94663949 TGTGAAATGGAAATGTGGGGTGG - Intergenic
935139903 2:100343830-100343852 TGTGGAAGGGAAATGTGGGGTGG + Intergenic
939075090 2:137590353-137590375 TCTGGAATGGAAATTTGTGCAGG + Intronic
939336971 2:140842337-140842359 TCTGGCATGGAAATGTAAGCTGG - Intronic
939439124 2:142220243-142220265 TCAGTAATGGTAATGTGAGAAGG - Intergenic
941218317 2:162740818-162740840 CCTGGAATGGTAATGGGAAGAGG - Intronic
941282469 2:163570580-163570602 TCAGGAATGACAATGTGAAGAGG + Intergenic
941578768 2:167268737-167268759 TGTAGAAGGGAAATGTGAGGTGG + Intergenic
944109783 2:196120065-196120087 TCTGGAATGAGCATGGGAGGGGG - Intergenic
945410444 2:209500255-209500277 CCTTGAATGACAATCTGAGGAGG - Intronic
945793294 2:214331685-214331707 TCTGGGATGGCCTTTTGAGGAGG - Intronic
945821762 2:214673570-214673592 TGAGGAATGGCAATGTGCAGTGG + Intergenic
946249911 2:218405695-218405717 TCCGGAATCGCCATGTTAGGAGG - Exonic
947011491 2:225571334-225571356 TGTGGAAGGGAAATGTGGGGTGG - Intronic
947276271 2:228395879-228395901 TATGGAAGGGAAATGTGGGGTGG - Intergenic
947552886 2:231059618-231059640 TCAGGAAAGGGAAAGTGAGGTGG - Intronic
948437438 2:237963211-237963233 GCTTGAATGCCAAAGTGAGGAGG - Intergenic
948593419 2:239065177-239065199 TCTGGCCTGGCATTGTGGGGCGG - Intronic
1168848880 20:963118-963140 TCTTGAATGGCACAGTGAAGGGG + Intronic
1168870197 20:1120910-1120932 TGTGGAATGGCAAGGAGAGAAGG - Intronic
1169399529 20:5268129-5268151 CCTGGAATGGCAGGGTAAGGAGG + Intergenic
1169451464 20:5715534-5715556 GCAGGAAAGGCCATGTGAGGAGG + Intergenic
1169549851 20:6691512-6691534 GCAGGAATGGGAACGTGAGGGGG - Intergenic
1172426102 20:34857135-34857157 TCTTGAATGGCAAGCTAAGGAGG - Intronic
1172747022 20:37218615-37218637 TCTGGAATGGCATTGTGGCAAGG - Intronic
1177573046 21:22913748-22913770 TTTAGAATGGTAATTTGAGGTGG - Intergenic
1177698851 21:24610229-24610251 TCTGGAATGGCTGTGTGAAGAGG - Intergenic
1177841457 21:26238598-26238620 TCTGGAGTGGCAATTTGAAGTGG + Intergenic
1178232393 21:30801535-30801557 TCATAAATGGCAGTGTGAGGAGG + Intergenic
1178240717 21:30896980-30897002 TTTGGAAGGCCAAGGTGAGGTGG + Intergenic
1179311365 21:40198741-40198763 TCTGGAGAGGCAGTGGGAGGTGG + Intronic
1180626917 22:17199617-17199639 TCTGGGATCGCCATTTGAGGTGG + Intronic
1181441466 22:22938052-22938074 TCTGGAAGGGGAATGTGGGTTGG - Intergenic
1183669061 22:39261543-39261565 TATGGAATCCCAATCTGAGGAGG + Intergenic
1183813833 22:40281931-40281953 TCAGGCCTGGCAAGGTGAGGAGG - Intronic
1184970598 22:48017176-48017198 GTTGGAAGGGCAATTTGAGGAGG - Intergenic
950731028 3:14957917-14957939 TGAGGAATGGCAATGTGGTGTGG - Intronic
950806088 3:15604125-15604147 TGTGGAAGGGAAATGTGGGGTGG - Intronic
952135644 3:30416314-30416336 TCTGGAAGGCCATTGTGAGGAGG + Intergenic
954388263 3:50255656-50255678 TGTAGAATGGGAATGGGAGGAGG - Intronic
954458107 3:50611013-50611035 TCTGGGATCCCAATGTGAGAAGG - Intronic
956347820 3:68299999-68300021 TGTGGAAGGGAAATGTGGGGTGG + Intronic
956745189 3:72305584-72305606 TCTGGAGGGCCCATGTGAGGAGG + Intergenic
958077775 3:88705954-88705976 TGTCTAATGGCTATGTGAGGAGG + Intergenic
958709994 3:97706741-97706763 TTTGGGATGGCTGTGTGAGGAGG - Intronic
959724693 3:109529971-109529993 TTTTGAATGGCAGTATGAGGGGG + Intergenic
959969058 3:112388249-112388271 ACTGCAATAGCAATGAGAGGTGG - Intergenic
960972675 3:123150751-123150773 TCTGGAAGGGCAGGGAGAGGGGG - Intronic
963013242 3:140795340-140795362 TATGTAATGGAAATGTGAGAAGG + Intergenic
964170902 3:153768496-153768518 CCTGGAATGGCAAGGTGATCTGG + Intergenic
965111943 3:164436289-164436311 TTTGGAATAGGAATGTGATGTGG + Intergenic
966446549 3:180007548-180007570 TGTGGAAGGGAAATGTGGGGTGG - Intronic
968579810 4:1384709-1384731 TCTGGGATGGCGATGGGTGGGGG - Intronic
969155592 4:5206909-5206931 TCTGGAATGGCACTTTGGGTGGG - Intronic
970929749 4:21495928-21495950 TCTGGAATGAGAATCTTAGGAGG - Intronic
971109699 4:23571795-23571817 TGTGCAATGGCAAAGTGAGAGGG + Intergenic
972110605 4:35553600-35553622 TCTTGAGTGACATTGTGAGGTGG - Intergenic
972386575 4:38572351-38572373 TCAGGGATGGACATGTGAGGCGG - Intergenic
972491423 4:39591028-39591050 TCTGGATTTGGAATCTGAGGGGG - Intronic
972839481 4:42914090-42914112 TGTGGAAGGGAAATGTGGGGTGG + Intronic
973781240 4:54290016-54290038 CCTGGAAAGGCAACGTGATGGGG + Intronic
974037257 4:56827821-56827843 TGTGGAAGGGAAATGTGGGGTGG + Intergenic
975804289 4:78096444-78096466 TGTGGAAGGGAAATGTGGGGTGG - Intronic
977014693 4:91678089-91678111 TGTGGAAGGGAAATGTGGGGTGG + Intergenic
977053660 4:92162652-92162674 TGTGGCATGGCTATGTGAGCTGG - Intergenic
978774327 4:112490690-112490712 TGTGGAAAGGAAATGTGAGGTGG - Intergenic
978981983 4:114958113-114958135 TGAGGAAGGGAAATGTGAGGTGG - Intronic
979177165 4:117679399-117679421 TGTGGAAGGGAAATGTGGGGTGG + Intergenic
980038985 4:127916932-127916954 TCTGGAAATGCAATGTGGGAGGG - Intergenic
980822727 4:138038141-138038163 TCCAGAAAGGCAGTGTGAGGAGG + Intergenic
981921270 4:150087431-150087453 TTTGAAATAGCAATGTGAGGAGG + Intronic
984126389 4:175816002-175816024 TCTGTAATGGCCAGGTGTGGTGG - Intronic
984203737 4:176760624-176760646 TCTGGCATAGATATGTGAGGGGG - Intronic
986716113 5:10524810-10524832 TCTGGAAAGGCCACGTGGGGAGG - Intergenic
987002585 5:13675129-13675151 TCTTGAATTGCCATGTGTGGTGG + Intergenic
988162884 5:27544086-27544108 TGTGGAAAGGAAATGTGGGGTGG + Intergenic
989004179 5:36791413-36791435 TTTGGAAATGAAATGTGAGGTGG - Intergenic
990710948 5:58579893-58579915 TATGGAAGGGCCACGTGAGGTGG + Intergenic
992138115 5:73768186-73768208 TGTGGATGGGAAATGTGAGGTGG + Intronic
993200830 5:84813002-84813024 TGTGGAAGGGAAATGTGGGGTGG + Intergenic
996571149 5:124933441-124933463 TCTGGAAAGGCAATCTGAGCAGG + Intergenic
997058936 5:130478143-130478165 TCAGGAATGAGACTGTGAGGTGG - Intergenic
997078546 5:130710589-130710611 TCTAGAATGGCAAAGTATGGTGG + Intergenic
997878050 5:137566385-137566407 ACTAGACTGTCAATGTGAGGAGG + Intronic
998926048 5:147127645-147127667 TGTGGAAGGGAAATGTGGGGTGG - Intergenic
999081715 5:148850556-148850578 TCTTGATTGGCAAAATGAGGAGG - Intergenic
999674171 5:153982444-153982466 TCTGGGTTGGCAGTGTGAGAGGG - Intergenic
1000768310 5:165319033-165319055 TGTGGAAGGGAAATGTGTGGTGG - Intergenic
1004292504 6:14381149-14381171 GCTGGAATGCCAATTTGAAGTGG - Intergenic
1005353329 6:24958808-24958830 TCTGGAATCACGGTGTGAGGAGG + Intronic
1005686985 6:28262593-28262615 TCTGGCAGGGCAGTGTGATGTGG + Intergenic
1006123964 6:31825812-31825834 TCTGAAAGGAAAATGTGAGGGGG - Intergenic
1006380040 6:33692112-33692134 TATGGAATGGGAGGGTGAGGGGG - Intronic
1007208575 6:40172692-40172714 TCTGGGAGGGCATTGGGAGGTGG + Intergenic
1009603535 6:65836194-65836216 GGAGGAATGGCAATGTGATGTGG + Intergenic
1009952518 6:70413577-70413599 GCTGTGATGGCGATGTGAGGGGG + Exonic
1010884391 6:81218264-81218286 TGTGGTATGGAAATGTGGGGTGG + Intergenic
1010920351 6:81673091-81673113 TGTGGAAGGGAAATGTGGGGTGG - Intronic
1011050942 6:83149140-83149162 TATGGAATGGAAAGGGGAGGGGG + Intronic
1011933070 6:92738121-92738143 TGTGGAAGGGAAATGTGAGGTGG + Intergenic
1012700500 6:102451271-102451293 TGTGGAAAGGAAATGTGGGGTGG - Intergenic
1012756682 6:103240568-103240590 TGTGGAAGGGAAATGTGAGTTGG + Intergenic
1013249773 6:108322482-108322504 TCAGGTATGGCCATGTGAGCAGG - Intronic
1013338689 6:109191856-109191878 TGTGGAAGGGAAATGTGGGGTGG + Intergenic
1013558743 6:111283549-111283571 TGTGGAAGGGAAATGTGGGGTGG - Intergenic
1014648293 6:124003619-124003641 GCTGGTATGGCAAAGTGAGTGGG + Intronic
1016143614 6:140643792-140643814 TGTGGAAGGGAAATGTGGGGTGG - Intergenic
1016790200 6:148060003-148060025 TCTGCAAGGGCAATGTGAAAGGG - Intergenic
1019933968 7:4242353-4242375 TATGGAATGGCAATGTGTATCGG - Intronic
1019935739 7:4256299-4256321 TCTGGAATGGCAATGTGAGGAGG - Intronic
1020276895 7:6630101-6630123 TCTGGAAGGGCAATGGGCAGAGG - Intergenic
1020711318 7:11609081-11609103 TCTGGCAGAGCAATGTGAGATGG - Intronic
1021385990 7:20031206-20031228 CCTGGAATAGCAATGGTAGGAGG + Intergenic
1021598573 7:22342004-22342026 TGTGGAAGGGGAATGTGGGGTGG - Intronic
1024487193 7:49932137-49932159 TGTGGAAGGGAAATGTGAGGTGG + Intronic
1024841773 7:53595284-53595306 TCTGGTATGACGATGTGATGAGG - Intergenic
1027569738 7:79849399-79849421 TCTGGAATGACAGTGTTTGGGGG + Intergenic
1028317502 7:89421718-89421740 TCTGGAATGGCAATATAGAGAGG - Intergenic
1029915584 7:104206662-104206684 TATTGCATGGCAATTTGAGGTGG - Intronic
1030038842 7:105431936-105431958 TGTGGACTGGTAATGTGTGGGGG - Intergenic
1031269605 7:119631037-119631059 TCTGGTATGTCCAAGTGAGGAGG - Intergenic
1032602403 7:133312430-133312452 TGAGAAATGGAAATGTGAGGTGG + Intronic
1033775083 7:144600618-144600640 TCTAGAATGTAAATGTGGGGTGG - Intronic
1033866441 7:145696305-145696327 TCTGGAATGGAAATGTGGTTTGG + Intergenic
1034866832 7:154649109-154649131 TCTGGAATGTCATGTTGAGGGGG + Intronic
1035003877 7:155640841-155640863 TGTGGATTGGCAAAGTGAGGAGG - Intronic
1036454953 8:8898392-8898414 TCTGGATTGGCAATGTGTGATGG + Intergenic
1039630015 8:39100540-39100562 TTTGGAATGACAATGTGGTGAGG - Intronic
1041825908 8:62096080-62096102 TGTGGAAGGGAAATGTGGGGTGG - Intergenic
1042585822 8:70336919-70336941 TCTGGAGGGGCCATGTGAAGAGG + Intronic
1042748764 8:72135462-72135484 TCTGGAATGGAGATTAGAGGGGG - Intergenic
1044467341 8:92523189-92523211 CTGGGAATGGAAATGTGAGGTGG - Intergenic
1045427594 8:102082526-102082548 TCTGGAATGGGAGTTGGAGGTGG - Intronic
1045682335 8:104676196-104676218 TGTGGATTTGCAATGTGAGCTGG + Intronic
1047042474 8:121011853-121011875 TTTGGCTTGGGAATGTGAGGAGG + Intergenic
1047285949 8:123487320-123487342 TCTTGAATGGCCAAGTCAGGAGG - Intergenic
1048602274 8:135931002-135931024 GCTGGTATGGCAATGGGATGGGG + Intergenic
1048729167 8:137418699-137418721 TGTGGAAGGGAAATGTGGGGTGG - Intergenic
1049233147 8:141494608-141494630 CCTGGAATGGGAACGTGAGATGG + Intergenic
1049454491 8:142680204-142680226 TCTGGCCTTGCACTGTGAGGTGG + Intronic
1050395556 9:5191406-5191428 TGGGGAATGGAAATGTGAGACGG - Intergenic
1051091517 9:13415013-13415035 TCAGGAATGGGAATATTAGGTGG + Intergenic
1051644150 9:19251052-19251074 TGTGGAAGGGAAATGTGGGGTGG - Intronic
1051743873 9:20276634-20276656 TGTGGAAGGGAAATGTGAAGGGG - Intergenic
1053675410 9:40420808-40420830 TGTGAAATGGAAATGTGGGGTGG + Intergenic
1054288682 9:63259334-63259356 TGTGAAATGGAAATGTGGGGTGG + Intergenic
1054386508 9:64560871-64560893 TGTGAAATGGAAATGTGGGGTGG + Intergenic
1054509212 9:65955484-65955506 TGTGAAATGGAAATGTGGGGTGG - Intergenic
1186120965 X:6360437-6360459 TTTGGAATGACAAAGTGAGGGGG - Intergenic
1186992465 X:15084670-15084692 TGTGGAAGGGAAATGTGGGGTGG + Intergenic
1187347792 X:18482224-18482246 TCCAGAATGGCAGTGTGAGGTGG - Intronic
1187598426 X:20800320-20800342 TGTGGAAGGGAAATGTGGGGTGG + Intergenic
1192932808 X:75825781-75825803 TGTGGAATGGAAATATGGGGTGG - Intergenic
1193718759 X:84963691-84963713 TTTGGAATGACAATGTGAGGAGG + Intergenic
1193721393 X:84991368-84991390 TCTGGTCTTGCAAAGTGAGGGGG - Intergenic
1195101136 X:101554990-101555012 GCTGGAATGGAAATGTAGGGAGG + Intergenic
1196715535 X:118807352-118807374 TCACGGATGGCAATGAGAGGAGG + Intergenic
1198178450 X:134180366-134180388 TCTGGACTGGGGATGTGAGGGGG - Intergenic
1198497133 X:137204097-137204119 TGTGGAAGGGAAATGTGGGGTGG - Intergenic
1200206445 X:154319944-154319966 TAAGGAATGGCAATGTAAAGTGG + Intronic
1200337646 X:155366916-155366938 TCTGGAAGAGGAATGTGATGGGG - Intergenic
1200348824 X:155474311-155474333 TCTGGAAGAGGAATGTGATGGGG + Intergenic
1200354816 X:155537494-155537516 ACTGGAATGGTAATAAGAGGTGG - Intronic