ID: 1019935740

View in Genome Browser
Species Human (GRCh38)
Location 7:4256302-4256324
Sequence ATTTCTGGAATGGCAATGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 258}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019935740_1019935749 18 Left 1019935740 7:4256302-4256324 CCTCACATTGCCATTCCAGAAAT 0: 1
1: 0
2: 5
3: 27
4: 258
Right 1019935749 7:4256343-4256365 AGTAACTCTGATATTCAGAGGGG No data
1019935740_1019935748 17 Left 1019935740 7:4256302-4256324 CCTCACATTGCCATTCCAGAAAT 0: 1
1: 0
2: 5
3: 27
4: 258
Right 1019935748 7:4256342-4256364 TAGTAACTCTGATATTCAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1019935740_1019935751 24 Left 1019935740 7:4256302-4256324 CCTCACATTGCCATTCCAGAAAT 0: 1
1: 0
2: 5
3: 27
4: 258
Right 1019935751 7:4256349-4256371 TCTGATATTCAGAGGGGACTGGG No data
1019935740_1019935744 -7 Left 1019935740 7:4256302-4256324 CCTCACATTGCCATTCCAGAAAT 0: 1
1: 0
2: 5
3: 27
4: 258
Right 1019935744 7:4256318-4256340 CAGAAATATCCTGGCCTTCATGG 0: 1
1: 0
2: 2
3: 21
4: 288
1019935740_1019935750 23 Left 1019935740 7:4256302-4256324 CCTCACATTGCCATTCCAGAAAT 0: 1
1: 0
2: 5
3: 27
4: 258
Right 1019935750 7:4256348-4256370 CTCTGATATTCAGAGGGGACTGG No data
1019935740_1019935747 16 Left 1019935740 7:4256302-4256324 CCTCACATTGCCATTCCAGAAAT 0: 1
1: 0
2: 5
3: 27
4: 258
Right 1019935747 7:4256341-4256363 CTAGTAACTCTGATATTCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019935740 Original CRISPR ATTTCTGGAATGGCAATGTG AGG (reversed) Intronic
900003051 1:25553-25575 ACTCCTGGAATTGCAAAGTGAGG + Intergenic
902714749 1:18264932-18264954 ATTTGTGGGATGGCACGGTGTGG - Intronic
903018056 1:20374564-20374586 ATTTCTGGAAGGGGAATGGTTGG - Intergenic
906722485 1:48019112-48019134 AGATCTGGGGTGGCAATGTGGGG + Intergenic
909520080 1:76557834-76557856 ATTTGTAGAATGGGAATGTGTGG + Intronic
910078920 1:83315610-83315632 ATGCCTGGAAAGGCCATGTGAGG + Intergenic
912141706 1:106737769-106737791 ATTTCTGGAATGGCAACATGTGG - Intergenic
915394489 1:155572422-155572444 ATTCCTGGAATGGCCGGGTGCGG + Intergenic
917195979 1:172466162-172466184 ATTTCTAGAAAGGAAATTTGAGG + Intronic
919282441 1:195508475-195508497 ATATCAGGAAAGGCCATGTGAGG + Intergenic
919390369 1:196976698-196976720 ACTTCGAGAATGGCTATGTGAGG - Intergenic
920130455 1:203727997-203728019 ATTCCTATAATGGCAGTGTGAGG - Intronic
920372644 1:205489246-205489268 GTTCCTGGAATGGCATGGTGTGG - Intergenic
922507409 1:226134521-226134543 CTGTCTGGCATGGCAATGTTTGG - Intergenic
923474292 1:234318275-234318297 ATTTCTGGAATGGACATGGTGGG + Intronic
924181290 1:241440872-241440894 ATTTATAGAATGGCACTGTGTGG + Intergenic
1065198351 10:23288633-23288655 ATATCTTGAATGGCAATATCAGG + Intronic
1068341030 10:55703566-55703588 ACTTCAAGAATGGCAATGGGAGG + Intergenic
1068560367 10:58508411-58508433 ATATCTGGAATAGGAATTTGAGG - Intergenic
1068632620 10:59313173-59313195 ATTTCTGGAATCACAATGACAGG - Intronic
1072067933 10:91888455-91888477 ATTTCTGGAATTTAAATTTGGGG + Intergenic
1072961416 10:99932827-99932849 ACTTCTGAAATGCCAATATGAGG - Intronic
1072964912 10:99963534-99963556 ACTTCTGAAATGCCAATATGAGG + Intronic
1075240929 10:120777716-120777738 CTTTCTAGAATGTCAATGAGGGG + Intergenic
1075969575 10:126641021-126641043 ATTTTTGGAATTTCAGTGTGTGG - Intronic
1076660664 10:132054118-132054140 ATTTCTGGAATGGCCAAGGATGG + Intergenic
1078472495 11:11602713-11602735 AGAACTGGAATGGCAGTGTGAGG - Intronic
1078656694 11:13247262-13247284 ATTTCTGGCAGTGCAATCTGAGG - Intergenic
1079736511 11:24003480-24003502 ATTTTTGGAATGGAAAAATGGGG + Intergenic
1080144480 11:28964372-28964394 ATTTCTGGAATATAAATGTGAGG - Intergenic
1082169525 11:48986183-48986205 ATTACTGGGATGTCCATGTGGGG - Intergenic
1084090672 11:66877577-66877599 ATTTCTGGAATAGTAATGACTGG - Intronic
1084918845 11:72452598-72452620 CTCTCTGGAAAGGCCATGTGAGG - Intergenic
1086612064 11:88769186-88769208 ACTTCTGGAGTGGGAATTTGTGG + Intronic
1086612067 11:88769201-88769223 ATTTGTGGATTGGCATGGTGAGG + Intronic
1086897975 11:92335473-92335495 ATTTTTGGAATGGAAGTGGGAGG - Intergenic
1086961605 11:92984189-92984211 CTTTCTGGCCTTGCAATGTGAGG + Intronic
1087846702 11:102981885-102981907 ATTTCTGGGGTGGCAAATTGTGG + Intergenic
1087946199 11:104163613-104163635 ATTTCCGGAATGGGACTGAGAGG - Intronic
1088784676 11:113170397-113170419 TTTTCTGTAAAGGCAGTGTGCGG + Intronic
1090753392 11:129766766-129766788 AATTCTGAAATGTTAATGTGTGG - Intergenic
1091188499 11:133669248-133669270 ATTTCCTGAATGCCAATATGAGG + Intergenic
1091353836 11:134919865-134919887 ATTTTGGAAATGGCAATGTTGGG + Intergenic
1092955173 12:13542923-13542945 TGGTCTGGAATGGCAATGAGGGG - Exonic
1093113073 12:15176131-15176153 ACTTCTGGAATGGCAGTATGAGG - Intronic
1094252111 12:28374130-28374152 ACTTCTGGAATGGCAATATGAGG - Intronic
1095428420 12:42105533-42105555 CTTCCTGGAATGGCAATCTAGGG + Intronic
1095545422 12:43362538-43362560 ACTTCTAGAATGGTGATGTGAGG + Intronic
1098432009 12:70429806-70429828 ATTTCTGTCTTGTCAATGTGAGG - Intronic
1098810127 12:75077388-75077410 ATTACTGAAATGACCATGTGTGG - Intronic
1099294639 12:80814763-80814785 ATTTCTGGAATTGAAAACTGTGG - Intronic
1099688571 12:85921726-85921748 ATTTCTAAAATGGCACTGTTGGG - Intergenic
1100200216 12:92290179-92290201 ATTTCTGGCAATGGAATGTGGGG + Intergenic
1102321434 12:111938900-111938922 ATATTTGGAATGGCATTGTTAGG + Intronic
1102490214 12:113286047-113286069 ATTTCTGGAATCGCAGAGGGAGG + Intronic
1102908102 12:116692981-116693003 AGATCTGGAAGGGCAAGGTGGGG - Intergenic
1103384774 12:120523399-120523421 ATTTCGGGACTGGCTGTGTGTGG + Intronic
1105825180 13:24116017-24116039 ATTTCTGCAATGTCATTTTGGGG + Intronic
1106193422 13:27473851-27473873 TTTGCTGGAAGGGCAGTGTGGGG - Intergenic
1106881494 13:34136523-34136545 CTCTCTGGAATGGCAGTGAGAGG + Intergenic
1106918947 13:34541511-34541533 CTTTGTGGAATGGAAAGGTGGGG + Intergenic
1108496039 13:51026295-51026317 ATTTCTGGACTGGAGATCTGTGG - Intergenic
1108978645 13:56482385-56482407 CTTTCAGGAATGACAATGAGTGG + Intergenic
1110526362 13:76543012-76543034 ACTTCCAGAATGGCAATGTGAGG + Intergenic
1111250744 13:85597971-85597993 TTTTGTGGATTGGTAATGTGTGG + Intergenic
1111490124 13:88961367-88961389 ATATCTGGACTTTCAATGTGTGG + Intergenic
1112104270 13:96223637-96223659 CTTTCTGGAATGGATATGGGGGG + Intronic
1112990375 13:105506273-105506295 GTTTCATGAATGGCAATGTTTGG - Intergenic
1113323180 13:109257275-109257297 CTCTTTGGAATGTCAATGTGAGG + Intergenic
1117705908 14:58467860-58467882 ATTTCTACAATGGCTATGTTAGG - Exonic
1118700322 14:68426707-68426729 TTTTCTGGAGAGGAAATGTGTGG + Intronic
1121292819 14:92791529-92791551 ACTTCTGGAATGGCAGAGTAAGG - Intergenic
1122242301 14:100376879-100376901 ATTTCTGGAATGCAAACGGGTGG - Intronic
1124060541 15:26289877-26289899 ACTTCTGGAATGGAGGTGTGAGG - Intergenic
1124222640 15:27863441-27863463 ACTTCTCCAATGCCAATGTGTGG + Intronic
1124519185 15:30394880-30394902 ATTTCTGGATTGGTAACTTGAGG + Intergenic
1124759179 15:32436231-32436253 ATTTCTGGATTGGTAACTTGAGG + Intergenic
1124856340 15:33392728-33392750 ACTACTGGAATGGCATTGAGGGG + Intronic
1124865202 15:33483631-33483653 ATTTCTGGAATGGCAAAATTTGG - Intronic
1124974491 15:34520340-34520362 ATTTCTGGATTGGTAACTTGAGG + Intergenic
1125384423 15:39122213-39122235 ATTTCTGAAATGGGAGTGAGAGG - Intergenic
1126374548 15:47983331-47983353 ATTTCTGGAATGGTTGTATGGGG + Intergenic
1128004420 15:64225410-64225432 ATGTCAGGAATGGGAATGTCTGG + Intronic
1128252789 15:66174628-66174650 ATTTCAGGAAGGGCATTATGGGG - Intronic
1128583869 15:68830172-68830194 ATTTTTAAAATGGCAATGTAGGG + Intronic
1131813819 15:96201777-96201799 AGTTCTGGAAGGGCAATGTTGGG - Intergenic
1131959244 15:97771626-97771648 ACTTCTGGAATGGCAGAGTAAGG + Intergenic
1132185898 15:99801421-99801443 ATTTCTGGATTGGTAACTTGAGG - Intergenic
1132281133 15:100616993-100617015 ATTTCTGGCATGGCAATCAGAGG - Intronic
1132318369 15:100907089-100907111 ATTGCAAGAATGGCAATGAGAGG - Intronic
1132429780 15:101751277-101751299 ATTTCTGGATTGGTAACTTGAGG + Intergenic
1132450451 15:101965385-101965407 ACTCCTGGAATTGCAAAGTGAGG - Intergenic
1133400608 16:5483817-5483839 ATTTGTGCAATGGCTTTGTGGGG + Intergenic
1133453311 16:5921569-5921591 ATTTCTGGAAAGGTAATGAAGGG + Intergenic
1135388356 16:22065842-22065864 ATTTCTGGAATGGCAAAGTAAGG + Intronic
1136864149 16:33728998-33729020 GTCACTGGATTGGCAATGTGAGG + Intergenic
1137302430 16:47165097-47165119 ACTATTGGAATGGCAGTGTGAGG - Intronic
1137323805 16:47412889-47412911 GGCTCAGGAATGGCAATGTGTGG - Intronic
1137399927 16:48145058-48145080 CTTTGTGGAGAGGCAATGTGGGG - Intronic
1139120938 16:64015874-64015896 ATGTCTGTTATGGCAATTTGGGG + Intergenic
1203125637 16_KI270728v1_random:1577135-1577157 GTCACTGGATTGGCAATGTGAGG + Intergenic
1143255467 17:5554426-5554448 ATTACTGGGATGTCAAGGTGGGG - Intronic
1148162206 17:45456841-45456863 CTTTCTGGAATTTCAGTGTGTGG + Intronic
1150393440 17:64803489-64803511 CTTTCTGGAATTTCAGTGTGTGG + Intergenic
1151281012 17:73073974-73073996 TTTTATGGAATTGGAATGTGAGG - Intronic
1155181360 18:23351031-23351053 ATTTCTGGCATGACAGAGTGAGG - Intronic
1157019568 18:43763035-43763057 ATTTCTGGAATTGTAATGCCAGG - Intergenic
1158154741 18:54412835-54412857 ATCTCTAGAATGGTAAGGTGGGG + Intergenic
1159126865 18:64234358-64234380 ATTTCTTTAATGGCAATGTCAGG - Intergenic
1160233866 18:77070027-77070049 ATTTTTGGAATAGCAATATCGGG - Intronic
1160277725 18:77453384-77453406 ATTTCTGCAAAGGCCCTGTGAGG + Intergenic
1160392403 18:78544306-78544328 ATTTCTGGAAGTGCAATCTCTGG + Intergenic
1160634802 19:67161-67183 ACTCCTGGAATTGCAAAGTGAGG + Intergenic
1161502911 19:4627144-4627166 ATTTCTGGAATAGCTATGGGGGG - Intergenic
1166034377 19:40156776-40156798 ATTTCTGGAATGTCAAGTTCAGG - Intergenic
1166703082 19:44893345-44893367 ATCTCTGGGGTGGCCATGTGGGG + Intronic
925599014 2:5589191-5589213 GTTTCTAGCATGGCCATGTGGGG - Intergenic
925747972 2:7060590-7060612 AAATCTGGAATGGAAATTTGGGG - Intronic
926496173 2:13591700-13591722 CTTTCTGAAATGCCAATGAGTGG + Intergenic
927852478 2:26508780-26508802 ATCTCTGAAATGTTAATGTGTGG - Intronic
928800632 2:35086422-35086444 ATTTTTTTAATGGCAGTGTGAGG - Intergenic
929868223 2:45736282-45736304 ATTTCTGAGATGGCAAACTGAGG + Intronic
930449237 2:51513716-51513738 ATGTCAGGAATGGCAGCGTGAGG + Intergenic
931204864 2:60137302-60137324 ATGTCTGGAATAGGAATGAGTGG + Intergenic
931611362 2:64104594-64104616 ATTTCTGAAATAGAAATGTAAGG + Intronic
932287805 2:70551896-70551918 AATTCTGGGATGGGAGTGTGGGG + Intronic
933280027 2:80322919-80322941 ATGCCTGGAATGGCAAGGGGTGG - Intronic
933970311 2:87464683-87464705 ATTGCTGGAATGGAGATCTGGGG - Intergenic
934632367 2:95941926-95941948 GTCACTGGATTGGCAATGTGAGG + Intronic
934801135 2:97161336-97161358 GTCACTGGATTGGCAATGTGAGG - Intronic
935884806 2:107605033-107605055 AATTCTGGAGTGACAGTGTGAGG - Intergenic
936323473 2:111485813-111485835 ATTGCTGGAATGGAGATCTGGGG + Intergenic
937206278 2:120238992-120239014 ATTCCAGGAAGGGCACTGTGAGG - Intergenic
940352442 2:152704575-152704597 ATTTCTTGACTGGCAATATTGGG - Intronic
941014961 2:160345247-160345269 ATTTCTGGTATGAAAATGTCTGG - Intronic
941072512 2:160970343-160970365 ATTTCTGGAATGGCAGAAAGTGG - Intergenic
941561116 2:167045863-167045885 ATTTCTGTAATGGGATTGTTGGG - Intronic
944038237 2:195323938-195323960 ATTTCCAGTATGGCAATGTTGGG + Intergenic
945052588 2:205838097-205838119 GACTATGGAATGGCAATGTGAGG + Intergenic
945511958 2:210713862-210713884 ATCTCAGGAATGGCAACATGAGG - Intergenic
947401299 2:229733879-229733901 TTTCCTGGAAAGGAAATGTGGGG - Intergenic
1169003792 20:2190069-2190091 ATTTCTGGAATAGCCGTCTGAGG - Intergenic
1170046879 20:12094674-12094696 ATTTGTTGAATAGCAATGAGTGG + Intergenic
1170717868 20:18847575-18847597 TTTTCTGGAAAGCAAATGTGAGG + Intergenic
1174367383 20:50064731-50064753 ATTTGTGTAATGGGAATGAGCGG - Intergenic
1174972587 20:55293186-55293208 TTTGCCGGAATGGCAATGTTTGG - Intergenic
1180224325 21:46380812-46380834 ACTTCTAGAATGGCAAAGTAAGG - Intronic
1181035489 22:20168040-20168062 ATTTCTGGATGGGCAAACTGAGG + Intergenic
1184589101 22:45469379-45469401 CTTTCTAGAATGCGAATGTGTGG + Intergenic
1184945876 22:47803452-47803474 TTTTCTGGAAGGGAGATGTGGGG + Intergenic
951876832 3:27436108-27436130 TTTTTTGGAATGGGGATGTGGGG - Intronic
956943500 3:74192836-74192858 ACTTCTGGAATGGCATAGTAAGG - Intergenic
958102605 3:89034105-89034127 ACTTGTGGAATGGTAATGTGAGG + Intergenic
958963259 3:100530764-100530786 ATATCTGTAATTGCAATGTATGG - Intronic
960791625 3:121437969-121437991 ATTTCTGGGAAGGCGATGGGTGG + Intronic
960861481 3:122158536-122158558 ACTTCTGGAATGGCACAGTAAGG - Intergenic
962174651 3:133140174-133140196 ATTTCTGGAATGGCTTAATGAGG - Intronic
963348644 3:144126251-144126273 ATATCTGGTACTGCAATGTGTGG + Intergenic
963881365 3:150532669-150532691 CTTTCTGGCATGGCAACCTGAGG + Intergenic
965025079 3:163291634-163291656 AAGTGTGGAATGGAAATGTGGGG - Intergenic
965468264 3:169059334-169059356 ATTTCTGGAAGGCTAATGTAGGG + Intergenic
966721643 3:183068651-183068673 ATTGATGGAATGTCATTGTGTGG - Intronic
968579813 4:1384712-1384734 GTTTCTGGGATGGCGATGGGTGG - Intronic
970354874 4:15242093-15242115 ATTTCTTTCATGCCAATGTGTGG + Intergenic
971905418 4:32718453-32718475 ATTTCTTGAAAGGCAAAGAGAGG - Intergenic
971944647 4:33257709-33257731 ATTTCTGGAAGGGGAAGGTAAGG + Intergenic
971964161 4:33530002-33530024 ATATTTGGAATGGGAATGGGTGG + Intergenic
972241797 4:37201429-37201451 ATTTCTGTCTTGGCTATGTGAGG - Intergenic
973344656 4:49041674-49041696 AGCACTGGAATGGCACTGTGTGG + Intronic
974924766 4:68283388-68283410 ATTTCTGGAATCCCAGTGTTTGG + Intergenic
975350871 4:73344555-73344577 ATTTCTGGGATGGCAAAATAAGG - Intergenic
976091583 4:81463833-81463855 AGTTCTGGAATTGAAAAGTGAGG + Intronic
976262436 4:83158430-83158452 AGTGCAGGAAAGGCAATGTGTGG + Intergenic
976622769 4:87145812-87145834 ATTCCTGGAAGGGAAATGTCTGG + Intergenic
977259740 4:94784183-94784205 ACTTCTAGAATGGCAGTATGAGG - Intronic
978543444 4:109843524-109843546 TATCCTGGAATGGCAATGTTTGG + Intronic
979286052 4:118925882-118925904 ATTTCTGAAATGTCAAGGTTGGG - Intronic
980354329 4:131723996-131724018 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980354866 4:131726502-131726524 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980355405 4:131728979-131729001 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980355952 4:131731480-131731502 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980356484 4:131733968-131733990 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980357024 4:131736456-131736478 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980357566 4:131738951-131738973 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980358102 4:131741437-131741459 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980358636 4:131743931-131743953 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980359178 4:131746404-131746426 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980359717 4:131748872-131748894 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980360257 4:131751367-131751389 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980360797 4:131753839-131753861 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980361342 4:131756322-131756344 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980361880 4:131758794-131758816 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980362425 4:131761277-131761299 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980362966 4:131763760-131763782 TTTCCTGGAAGGCCAATGTGGGG - Intergenic
980468813 4:133222549-133222571 ATTTCTGGAATCTCTATTTGTGG + Intergenic
980893761 4:138841448-138841470 CTTTTTGGAATGGGAATGGGAGG - Intergenic
980905709 4:138946845-138946867 ATTTCAGGAATGTAAAAGTGGGG + Intergenic
981921269 4:150087428-150087450 ACTTTTGAAATAGCAATGTGAGG + Intronic
982291228 4:153784639-153784661 ATTTCTGGGATGGCAAGGTAAGG + Intronic
982476741 4:155862077-155862099 ACTTCCAGAATGGCAAAGTGAGG - Intronic
985715565 5:1457737-1457759 ATGTCTGTAATGTCAATGGGTGG + Intronic
986153777 5:5152887-5152909 ACTTCCAGAATGGCAATTTGAGG - Intronic
986983464 5:13475070-13475092 TTTTGTGGAAGGGAAATGTGGGG + Intergenic
987524546 5:19030545-19030567 ACTTCTGGAATGGCGGTATGAGG + Intergenic
989724633 5:44573775-44573797 ATTTCTGGACTGGAAGAGTGTGG - Intergenic
989776725 5:45217733-45217755 AATTCTGGATTGGCTATTTGGGG - Intergenic
990312220 5:54550945-54550967 CTTTCAGGAATGGGAATGGGGGG + Intergenic
990325805 5:54674209-54674231 ATTTCTTCAATGGCAAACTGGGG + Intergenic
990866815 5:60389024-60389046 ATTTCTTGGATGGCAAAATGTGG - Intronic
991666293 5:69003069-69003091 ATATCTAGAATGGGATTGTGGGG - Intergenic
993139231 5:84009100-84009122 ATTCCTGAAGTGGCCATGTGCGG - Intronic
993161340 5:84296006-84296028 ATTTCTGCATTGGCAAAATGGGG + Intronic
994433473 5:99698188-99698210 ATATCTTGAATGGAAATGTTTGG - Intergenic
994808540 5:104481923-104481945 ATTTCTGGAATGACATAGTGAGG - Intergenic
997078545 5:130710586-130710608 ATGTCTAGAATGGCAAAGTATGG + Intergenic
1001214367 5:169841564-169841586 ATTTCAGGCCTGGCAATGTTTGG - Intronic
1002920928 6:1572688-1572710 ACTTCTGGAATGGTGGTGTGAGG - Intergenic
1006393238 6:33771150-33771172 GTCTAAGGAATGGCAATGTGTGG - Intergenic
1006640976 6:35489705-35489727 ATTCTTGGAATAGAAATGTGAGG + Intronic
1007869252 6:45014070-45014092 ACTTCTGAAATGGCTATGTAAGG - Intronic
1009325372 6:62342559-62342581 ATTTCTGGGATGGGTATGTAAGG + Intergenic
1009617336 6:66026640-66026662 ATATTTGGAATGGGAATGTGGGG + Intergenic
1009619867 6:66062074-66062096 ATTTTTAGAAAAGCAATGTGTGG - Intergenic
1012206259 6:96464274-96464296 ATTTCTGGAACAGAAATGTTAGG - Intergenic
1012417679 6:99027237-99027259 ATTTCTGTCATGGCAATGGCTGG + Intergenic
1014229027 6:118881657-118881679 ACTTCTGCAATGGCAGTGTGAGG + Intronic
1016036814 6:139391772-139391794 ATTTCTGGAATGTACAAGTGAGG + Intergenic
1016617860 6:146073815-146073837 AATTCTGGAATTGCATTGTGAGG + Intronic
1017197869 6:151721725-151721747 ATTTCTGGAAAGGAGAGGTGGGG - Intronic
1017510555 6:155111001-155111023 ATTTCTAAAATGGAGATGTGGGG + Intronic
1018990474 6:168669879-168669901 ATTTCTGGTGTGGCAATGATGGG - Intronic
1019935740 7:4256302-4256324 ATTTCTGGAATGGCAATGTGAGG - Intronic
1022164061 7:27740489-27740511 AGTTTTGGAATGGCAACGGGTGG + Intronic
1022268363 7:28781368-28781390 ATTTCTAAAATGTTAATGTGTGG + Intronic
1023140645 7:37098696-37098718 CTTTCTGGAATGGGAATTTCTGG - Intronic
1024163899 7:46710552-46710574 TTTTTTGTAATGGTAATGTGTGG + Intronic
1025127799 7:56357787-56357809 ATTTCTTGAATGGCAAATTCAGG - Intergenic
1027296695 7:76780885-76780907 ATGCCTGGAAAGGCCATGTGAGG + Intergenic
1027698713 7:81442361-81442383 TTTTGTGGAATGGCAACATGTGG + Intergenic
1028462155 7:91106200-91106222 AGTTCTGCAATTGCAATGTTAGG - Intronic
1028956574 7:96700215-96700237 ATCACTGGAAAGGCAATTTGTGG + Intronic
1030565383 7:111147728-111147750 ACTTCTGGAATGGTAAAGTAAGG + Intronic
1031116685 7:117676472-117676494 ATTTCTAGAACAGCAAGGTGAGG - Intronic
1033775084 7:144600621-144600643 ATTTCTAGAATGTAAATGTGGGG - Intronic
1036012091 8:4737426-4737448 ATTTTTGTTATGGCAATTTGTGG - Intronic
1037906865 8:22720613-22720635 AAATCTGGAAAGGCAAAGTGTGG + Intronic
1037943554 8:22972837-22972859 ATATCTGGAAGGGCCTTGTGAGG - Intronic
1039139246 8:34366812-34366834 ATTTTTGAAATGTCAATGTCTGG + Intergenic
1039651412 8:39343168-39343190 TTTTCAGGAATGGAAATATGGGG - Intergenic
1040628899 8:49185418-49185440 ACTTCTGGAATTGCACTGGGTGG - Intergenic
1040790545 8:51223892-51223914 ATTTCCAGAATGGCTACGTGAGG + Intergenic
1041792804 8:61715069-61715091 ATTTCTGGAATGGTGATATTAGG + Intergenic
1042106153 8:65328412-65328434 ATTTGAGGAAGGGCAATCTGAGG + Intergenic
1048194904 8:132324467-132324489 TTTTCTTAGATGGCAATGTGGGG - Intronic
1048871177 8:138800441-138800463 ACTTCTGAAATGGCAACATGAGG - Intronic
1049754603 8:144304382-144304404 ACTTCTGGAACAGCAATGTGAGG - Intronic
1049757676 8:144318014-144318036 AGATCTGGAATGGGAATGGGGGG + Exonic
1049885855 9:25666-25688 ACTCCTGGAATTGCAAAGTGAGG + Intergenic
1050134820 9:2451177-2451199 ACTTCTGGAATGACAGTGTGAGG - Intergenic
1050879229 9:10678369-10678391 ATTTCTGGGATCCCTATGTGTGG + Intergenic
1051427475 9:16947826-16947848 ATTTCTGGAAAGGCAGTGTAGGG - Intergenic
1052894898 9:33737742-33737764 AATTCTGAAATGTTAATGTGTGG - Intergenic
1053321026 9:37098898-37098920 ATCTCTGGGCTGGGAATGTGGGG - Intergenic
1056032989 9:82572424-82572446 ATTTCTGGAGTTTCAATATGAGG - Intergenic
1057190908 9:93087150-93087172 ATTTCTGGAGTGGGACTGTGAGG + Intergenic
1058853062 9:109032297-109032319 ATTTCTGGATTGGGGATGGGAGG - Intronic
1060215468 9:121736175-121736197 AATGTTGGAATGGAAATGTGGGG + Intronic
1061060580 9:128248340-128248362 ATTTCTGGATTGGGAAATTGAGG + Intronic
1187347793 X:18482227-18482249 ACTTCCAGAATGGCAGTGTGAGG - Intronic
1189531884 X:41893140-41893162 ACTTCTGGAATGGCGGAGTGAGG + Intronic
1189668532 X:43383230-43383252 ATTTCCAGAATGGCAGAGTGAGG + Intergenic
1189811680 X:44786644-44786666 ACTTCTGGAATGGCAGAGTGAGG + Intergenic
1190471041 X:50779870-50779892 ATTCCTGGAAGGGGAATGTGGGG + Intronic
1190539832 X:51465742-51465764 ACTTCTGGAATGGTAGTGTGAGG - Intergenic
1190574968 X:51826248-51826270 AATTCTGGAATGGCTATGTGAGG - Intronic
1191580707 X:62757777-62757799 ATTTCAGGAAAGGCCATGAGGGG - Intergenic
1192673391 X:73169530-73169552 GCTTCTGGATTGGCAAGGTGAGG - Intergenic
1193272721 X:79547543-79547565 ACTCATGGAATGGCAATGTGAGG - Intergenic
1193469981 X:81888627-81888649 ATTTTTGCAATCTCAATGTGTGG - Intergenic
1193698271 X:84735831-84735853 AATTCTGGAATGACAGTGTGAGG - Intergenic
1193718758 X:84963688-84963710 ATTTTTGGAATGACAATGTGAGG + Intergenic
1194998201 X:100614793-100614815 ACTTCTGGAATGGCGCAGTGAGG + Intergenic
1195849722 X:109270178-109270200 ATGTCTGGGATAGCAGTGTGAGG - Intergenic
1196058980 X:111387108-111387130 ATTTCTGGGCTGGCATTGTGAGG - Intronic
1196202152 X:112898550-112898572 ATTTCTTGAAAGGCAACATGAGG - Intergenic
1197457687 X:126698558-126698580 ACTTTTGGAATGGCAAAGTAAGG + Intergenic
1197469158 X:126846632-126846654 ATGTCTGGCTTGGCACTGTGAGG - Intergenic
1197522608 X:127519196-127519218 AATGCTAGAATGGCAATGTATGG - Intergenic
1197827101 X:130601430-130601452 ACTTCTGGAATGGTGGTGTGAGG - Intergenic
1200375927 X:155780167-155780189 AGTTTGGGAATGACAATGTGTGG - Exonic
1201327213 Y:12775013-12775035 ATTTCAGGAATGAAAATTTGGGG - Intronic