ID: 1019935742

View in Genome Browser
Species Human (GRCh38)
Location 7:4256312-4256334
Sequence AGGCCAGGATATTTCTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 222}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019935742_1019935748 7 Left 1019935742 7:4256312-4256334 CCATTCCAGAAATATCCTGGCCT 0: 1
1: 1
2: 0
3: 22
4: 222
Right 1019935748 7:4256342-4256364 TAGTAACTCTGATATTCAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1019935742_1019935751 14 Left 1019935742 7:4256312-4256334 CCATTCCAGAAATATCCTGGCCT 0: 1
1: 1
2: 0
3: 22
4: 222
Right 1019935751 7:4256349-4256371 TCTGATATTCAGAGGGGACTGGG No data
1019935742_1019935750 13 Left 1019935742 7:4256312-4256334 CCATTCCAGAAATATCCTGGCCT 0: 1
1: 1
2: 0
3: 22
4: 222
Right 1019935750 7:4256348-4256370 CTCTGATATTCAGAGGGGACTGG No data
1019935742_1019935749 8 Left 1019935742 7:4256312-4256334 CCATTCCAGAAATATCCTGGCCT 0: 1
1: 1
2: 0
3: 22
4: 222
Right 1019935749 7:4256343-4256365 AGTAACTCTGATATTCAGAGGGG No data
1019935742_1019935747 6 Left 1019935742 7:4256312-4256334 CCATTCCAGAAATATCCTGGCCT 0: 1
1: 1
2: 0
3: 22
4: 222
Right 1019935747 7:4256341-4256363 CTAGTAACTCTGATATTCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 127
1019935742_1019935753 26 Left 1019935742 7:4256312-4256334 CCATTCCAGAAATATCCTGGCCT 0: 1
1: 1
2: 0
3: 22
4: 222
Right 1019935753 7:4256361-4256383 AGGGGACTGGGAAGAAATGTGGG No data
1019935742_1019935752 25 Left 1019935742 7:4256312-4256334 CCATTCCAGAAATATCCTGGCCT 0: 1
1: 1
2: 0
3: 22
4: 222
Right 1019935752 7:4256360-4256382 GAGGGGACTGGGAAGAAATGTGG 0: 1
1: 1
2: 5
3: 68
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019935742 Original CRISPR AGGCCAGGATATTTCTGGAA TGG (reversed) Intronic
901001486 1:6151000-6151022 AGGCCAAGAACTCTCTGGAAGGG + Intronic
902740671 1:18435965-18435987 AGGCCAGGGTCTTCCAGGAATGG - Intergenic
904393192 1:30199236-30199258 AGTCCAGTCTATTTCTGGGAGGG + Intergenic
904462499 1:30688538-30688560 TGGCCAGGAGAGATCTGGAAAGG + Intergenic
906109785 1:43314959-43314981 AGGCCAGCACAATTCTGGAGTGG - Intronic
906724047 1:48030724-48030746 AGGGCAGGATTTGTCTGGATGGG + Intergenic
911182037 1:94869775-94869797 ATGCAAGGAAATTTCTGAAAAGG - Intronic
914334301 1:146700903-146700925 AAGACAGGATGTTTATGGAAGGG - Intergenic
914677168 1:149914132-149914154 AAGCCAGGATAACTCAGGAAGGG + Exonic
914863140 1:151403141-151403163 TGGCCAAGCTGTTTCTGGAAGGG + Exonic
915436501 1:155910877-155910899 AGGCCAGAATATGTATGGAAAGG - Exonic
915900309 1:159842016-159842038 AGGCAGAGATCTTTCTGGAAGGG - Intronic
916809862 1:168295966-168295988 AGGCCGGGAGATTGCTGGATGGG - Intronic
916981210 1:170139294-170139316 AGGAGAGGATACATCTGGAATGG - Intergenic
917822253 1:178775557-178775579 ATGACAGGTTATTTATGGAAAGG + Intronic
917921087 1:179750498-179750520 GGGAGAGGATATTCCTGGAATGG + Intronic
918060549 1:181057356-181057378 AGGCAAGTTTATTTCTGGAATGG + Exonic
921822846 1:219637443-219637465 AGCCTAGGAAATTTGTGGAAGGG - Intergenic
924622451 1:245673497-245673519 AGGCCAGGAAATATCTGAAAGGG - Intronic
1063672039 10:8106744-8106766 ATGCCAGTTTTTTTCTGGAAGGG + Intergenic
1067264958 10:44733545-44733567 AGCCCAGGATATTTCTTTAGGGG + Intergenic
1067426583 10:46215698-46215720 AGGGGAGGATCCTTCTGGAAGGG - Intergenic
1071275524 10:84050981-84051003 AGGCCAGACTAACTCTGGAAAGG + Intergenic
1071793983 10:88985866-88985888 AGGGCATTATACTTCTGGAAAGG - Intronic
1073459072 10:103655328-103655350 AGGCTAGGCTGTTTCTAGAAGGG - Intronic
1077743540 11:4875281-4875303 AAGACTGGATATTTCTGAAAAGG + Intronic
1078555519 11:12322315-12322337 CAGCTAGGATCTTTCTGGAAAGG - Intronic
1078940820 11:16003303-16003325 TGGCCAGGTAATTTCAGGAAAGG - Intronic
1080661110 11:34296638-34296660 AGGCCAGCATCTTCCAGGAAGGG + Intronic
1081726731 11:45335139-45335161 AGGCCACAGTGTTTCTGGAAAGG + Intergenic
1082932955 11:58628191-58628213 AGGTCAGGACATTTCTTAAAAGG + Intergenic
1083705402 11:64510805-64510827 TGTCCAGGACATTTCTGAAAGGG + Intergenic
1084432297 11:69117837-69117859 ATGCCAGGCCATTTCAGGAAGGG - Intergenic
1087635298 11:100695285-100695307 CAGCCTGGATATTTCTGGTAGGG + Intronic
1088763907 11:112958518-112958540 AGGCCATGATAGCTCTGGATAGG - Intergenic
1089157208 11:116411461-116411483 AGGACAGGTTAATTCTGAAAAGG + Intergenic
1089370319 11:117950901-117950923 AGGTCTGGATCTTTCTAGAAAGG - Intergenic
1090604946 11:128411909-128411931 AAGCCATGTTATTTCTGGCAAGG + Intergenic
1090611987 11:128479668-128479690 AGGCCAGGATGGATCTGGACAGG + Intronic
1093001058 12:13996417-13996439 TGGCCAGGATGCTTCTGGAGTGG - Intergenic
1093834640 12:23813062-23813084 AGCCAAAGATTTTTCTGGAATGG - Intronic
1094825337 12:34264980-34265002 AGGCCAGGATATTTTCAAAATGG + Intergenic
1099079980 12:78165296-78165318 AGGCTGGGATAATTCTGCAAAGG - Intronic
1100103410 12:91138538-91138560 AGGAAAGGAGATCTCTGGAATGG - Intergenic
1100802463 12:98247634-98247656 ATGGCAGGATATTTCTGATAGGG - Intergenic
1101531877 12:105580813-105580835 AGGCCAGGTGATTTCTGGCTTGG - Intergenic
1102678336 12:114673488-114673510 AGGCCAGCCTATTCCTCGAAGGG - Intronic
1102947500 12:117002292-117002314 AGGCCAAGATATTTCAGGGATGG - Intronic
1103498662 12:121383136-121383158 AGGCTTCGATATTTTTGGAAAGG + Intronic
1103803402 12:123554323-123554345 AGGCCAGTCTATTACTTGAAGGG + Intergenic
1103960782 12:124607840-124607862 AGGCCAGGATGTGCCTGGTAGGG + Intergenic
1104502773 12:129302436-129302458 AGGCCAGGATATGTCTCCGAGGG + Intronic
1106945499 13:34823284-34823306 AGCCCAGGATATTTTAGGATAGG - Intergenic
1107099233 13:36571426-36571448 AAGTGAGGATATTTCTGGTAAGG - Intergenic
1107750353 13:43558480-43558502 GAGCCAGGATATTTCTAGGATGG + Intronic
1112069953 13:95838760-95838782 AGGCCAGGTTATTTAAGGAAGGG - Intronic
1114009058 14:18348005-18348027 AGGCCAGCATCTTTGGGGAAAGG + Intergenic
1116095808 14:40365367-40365389 AGGTTAAGATATTTGTGGAAAGG - Intergenic
1118455142 14:65938748-65938770 AGGCCAGGATGATTCTCCAAGGG - Intergenic
1121309912 14:92930080-92930102 AGGGCAGGAGATCTCTGGCATGG + Intronic
1121675904 14:95752704-95752726 AGCCCAAAACATTTCTGGAATGG - Intergenic
1121740943 14:96252076-96252098 AGGAGAGGTTATTTCAGGAAAGG + Intronic
1121912836 14:97807538-97807560 AGGACATGTTATTTCTGGAAGGG + Intergenic
1123392256 15:19888608-19888630 AGGCCAGCATCTTTGGGGAAAGG + Intergenic
1126158736 15:45588798-45588820 AGTACAGGATACTTCTGGAGAGG - Intronic
1126310085 15:47305769-47305791 AGGCCAGGATACTTCTGTGAAGG + Intronic
1126864212 15:52920053-52920075 AGCCCAGGGTCTTCCTGGAAAGG - Intergenic
1128418832 15:67472394-67472416 AGGCCTGAATATTTCTGAATAGG + Intronic
1131649031 15:94378777-94378799 AGGCCAGGACCCATCTGGAAAGG + Intronic
1132292375 15:100712590-100712612 GGGCCAGGGAATTTCTGGAATGG + Intergenic
1132376186 15:101329804-101329826 AGGCCAGGACATTACTGGCATGG - Intronic
1133393597 16:5428734-5428756 AGGCCAGGAGGTTTCTGGGTTGG + Intergenic
1133630224 16:7613458-7613480 TGGCCAGGTTCTTTCTGAAATGG - Intronic
1136717042 16:32289372-32289394 GGGCCTGCATCTTTCTGGAAAGG - Intergenic
1136835419 16:33495617-33495639 GGGCCTGCATCTTTCTGGAAAGG - Intergenic
1137817498 16:51412752-51412774 AGTACAGTATATTTCTGGTAAGG - Intergenic
1139406562 16:66723641-66723663 AGACCAGGATTTTTCTGATATGG - Exonic
1139999315 16:71010329-71010351 AAGACAGGATGTTTATGGAAGGG + Intronic
1203009384 16_KI270728v1_random:228415-228437 GGGCCTGCATCTTTCTGGAAAGG + Intergenic
1142837538 17:2599072-2599094 TGTCAAGGATACTTCTGGAATGG + Intronic
1144711883 17:17406584-17406606 TGGCCAAGCTATTTCAGGAAAGG - Intergenic
1146408649 17:32562763-32562785 CGGACAGGATATTTCTTAAAAGG + Intronic
1146704175 17:34988283-34988305 AGGACAGCATGTTTCTGGAAGGG + Intronic
1148128604 17:45249126-45249148 AGGCCAGGATTTTGTGGGAAGGG + Intergenic
1148488182 17:48004792-48004814 AGGCCTGAATATTTGGGGAAAGG + Intergenic
1149850397 17:60030455-60030477 GGGCCAGGATGTTTGTGGGAGGG + Intergenic
1149859769 17:60116069-60116091 GGGCCAGGATGTTTGTGGGAGGG - Intergenic
1150337343 17:64340404-64340426 GGTCCAGGACATTTCTGCAAAGG - Intronic
1152782614 17:82232872-82232894 AGGCCAGGTTATTTCTGGGTGGG + Intronic
1153027967 18:688402-688424 AGGCCAGGCTCTTTCTCTAAAGG - Intronic
1154377554 18:13822607-13822629 AGGCCAGGATATTTGGTGAGAGG + Intergenic
1155337877 18:24783909-24783931 AGTCCAGGTAATTTCTGGAGTGG - Intergenic
1156464042 18:37337343-37337365 AGGCCAGGCCATCTCAGGAAAGG - Intronic
1160294762 18:77627766-77627788 ATGCCTGGAAATTTCTGGAGTGG + Intergenic
1167909581 19:52690720-52690742 AGCCCTGGAATTTTCTGGAACGG + Intergenic
927972729 2:27315960-27315982 AGGCCAGGGTATTCCTGGCATGG + Intronic
928203960 2:29270988-29271010 AGGCCAGGATTTTTCGGAACTGG + Intronic
929603859 2:43221909-43221931 AGGCCAGGCTTTTTCTGGGTCGG - Intergenic
930368459 2:50473782-50473804 AAGACAGAATATTTCTGGATGGG - Intronic
931721424 2:65070080-65070102 AGGCCAGGGGAATTCTGGCAAGG + Intronic
932585404 2:73024691-73024713 AGGCCAGTATATTTTTTTAATGG + Intronic
933906777 2:86901956-86901978 AGGGCAGTATATGTGTGGAAAGG + Intergenic
934024699 2:87991678-87991700 AGGGCAGTATATGTGTGGAAAGG - Intergenic
935775771 2:106469755-106469777 AGGGCAGTATATGTGTGGAAAGG - Intergenic
936365387 2:111849715-111849737 AGGGCAGTATATGTGTGGAAAGG - Intronic
937886360 2:126902192-126902214 AGGACAGGATGATTCTGGAGAGG - Intergenic
938237765 2:129720638-129720660 AGACCAGGATATCTATGGAAGGG - Intergenic
940068258 2:149654056-149654078 GGTCCAGGAGAATTCTGGAAAGG - Intergenic
941345334 2:164361704-164361726 AGGCCAGGGTAGTTCTAGATCGG - Intergenic
941575532 2:167225460-167225482 AGGTCAGTATATTTCTATAACGG + Intronic
942102989 2:172604554-172604576 AGGCCATGATTTTTCTGAACTGG - Intronic
942346291 2:175005573-175005595 AGCCCAGGTTTTTTCTTGAATGG + Intergenic
942422467 2:175822017-175822039 AGGCTAAGATGTTTCTGCAATGG - Intergenic
943845692 2:192643841-192643863 ATTCCAGGATATTTTTGGAGGGG + Intergenic
944124091 2:196273988-196274010 AGGACAGATGATTTCTGGAAAGG + Intronic
944355186 2:198779013-198779035 GGGCCAGGAAATGACTGGAAAGG - Intergenic
945638856 2:212396591-212396613 AGGCCATGAAATTTCTGTAAGGG - Intronic
946444549 2:219727096-219727118 GGGCCAGGGTGTTTGTGGAAGGG + Intergenic
947454171 2:230237925-230237947 TGGCCAGGTTATTTCAGGAGTGG - Intronic
947633524 2:231668424-231668446 TGGCCAGGATATTTTTTAAATGG + Intergenic
947916295 2:233833961-233833983 AGGCCAGGACACTTCTTAAAGGG + Intronic
1170182770 20:13551545-13551567 AGCCCTGGATATGACTGGAAGGG - Intronic
1174110404 20:48194445-48194467 GGGCCTGGAAAGTTCTGGAAGGG - Intergenic
1174224399 20:48985222-48985244 AGGACAGGCTGCTTCTGGAATGG + Intronic
1175032540 20:55970166-55970188 AGGCCAGGCTATTCCTTAAACGG + Intergenic
1175365999 20:58456591-58456613 TAGCCAGGATATATCTAGAAAGG - Intergenic
1176161623 20:63651659-63651681 AGGCCTCAATATTTCAGGAAAGG - Intronic
1176907443 21:14520005-14520027 AAGCAAGCATATTTCTGCAATGG + Intronic
1177956962 21:27610014-27610036 GGGCCAACAGATTTCTGGAAGGG + Intergenic
1178153047 21:29818414-29818436 AGGCCAGGATTTATGTAGAAAGG - Intronic
1178442933 21:32613066-32613088 ATGGCTGGATATTTCTGGGAGGG - Intergenic
1178626627 21:34223934-34223956 AGCCCAGGATGCTTATGGAATGG + Intergenic
1179255147 21:39709514-39709536 AGTCCAAGATGTTACTGGAAAGG + Intergenic
1179581058 21:42344247-42344269 AGGCCAGTGGATTCCTGGAAAGG - Intergenic
1180433558 22:15278815-15278837 AGGCCAGCATCTTTGGGGAAAGG + Intergenic
1180516117 22:16146724-16146746 AGGCCAGCATCTTTGGGGAAAGG + Intergenic
1183348500 22:37320832-37320854 AGGCCAGGGCATTTCTGGATGGG - Intergenic
1183785466 22:40026731-40026753 ACCCCAGGAGAGTTCTGGAAAGG - Intronic
949401198 3:3666686-3666708 AAACCAGGATATTTCTTAAATGG - Intergenic
949409145 3:3744887-3744909 TGACCAGGATTTTTCTGGAGAGG - Intronic
950829456 3:15859736-15859758 CTGCCAGGGTATTTCGGGAAGGG - Exonic
950953299 3:17024056-17024078 AGGCCTAGGTATTTCTGGGAGGG + Intronic
954421174 3:50419844-50419866 AGGCCTGGTTAGTACTGGAATGG + Intronic
955388571 3:58500619-58500641 AGGCCAGAATATATGTGGGAAGG - Intronic
957170121 3:76727730-76727752 AGGCTAGGAAATGTCAGGAAGGG + Intronic
957973795 3:87417405-87417427 CTGTAAGGATATTTCTGGAAGGG + Intergenic
958255640 3:91321706-91321728 AGGTCAGGATAGTGCTGGGAGGG - Intergenic
960885554 3:122390537-122390559 TGGAAAGGATATTTATGGAAAGG + Intronic
962854307 3:139330188-139330210 AGGGCAGGACACTTCTGGGAAGG - Intronic
963948089 3:151168512-151168534 AGGCACGCACATTTCTGGAAGGG + Intronic
964405233 3:156341960-156341982 GTACCAGGATATGTCTGGAAAGG + Intronic
964802983 3:160574569-160574591 AGGCCAGGGTCTATCTAGAATGG - Intergenic
965950289 3:174300265-174300287 AGGAATGGATTTTTCTGGAATGG + Intergenic
967254622 3:187577023-187577045 GGGCCTGGAGATTTCTGGAAGGG + Intergenic
969350037 4:6593171-6593193 AGGTCAGGATTTTACTGGAATGG + Exonic
969490710 4:7497815-7497837 AGGCCATGGATTTTCTGGAAAGG - Intronic
969985535 4:11206154-11206176 AGGCCAGGAAATTTTAGGATGGG - Intergenic
970556760 4:17241661-17241683 AGGCAAGACTGTTTCTGGAATGG - Intergenic
971643911 4:29171619-29171641 ACAACAGGATACTTCTGGAAGGG - Intergenic
973696580 4:53496441-53496463 GGGCCTGGATCTTTCAGGAAGGG - Intronic
974426900 4:61753375-61753397 AAGCCAGGAAATTTATTGAATGG - Intronic
974949234 4:68568470-68568492 AGACCAGGATGTCTCTGAAATGG - Exonic
974958265 4:68670604-68670626 AGACCAGGATGTCTCTGAAATGG - Exonic
974979862 4:68941575-68941597 AGGCAAGGATTTTTTTGGATAGG + Intronic
975263322 4:72331205-72331227 AGGTCAGGATATTCCTGGGAAGG + Intronic
977208692 4:94193251-94193273 AGGACAGGAGAATTCTGGAATGG - Intergenic
978285330 4:107071651-107071673 AGGCAATGATATTTCAGGAATGG - Intronic
979195984 4:117920574-117920596 AGACCAGGATTTTCCTGGCAAGG - Intergenic
980878587 4:138686822-138686844 AGGACAGGAGAATTCGGGAAGGG - Intergenic
983570042 4:169196765-169196787 GGGCCAGGAGCTTTCTGTAATGG - Intronic
984213930 4:176884325-176884347 AGGCCAGGACATCGCAGGAAGGG + Intergenic
986177423 5:5364188-5364210 AGGCCAGGCTATTTCTGGAAGGG + Intergenic
987477625 5:18411072-18411094 AGGCCAGCAAACTTCTGGTATGG - Intergenic
991010183 5:61874163-61874185 AAGTCATGATATCTCTGGAAAGG + Intergenic
991165175 5:63558745-63558767 AGGCCTGGTGATTTCTGGATGGG + Intergenic
992473578 5:77081117-77081139 TGGCCAGGAAATTTATGAAAAGG + Intronic
994512782 5:100726710-100726732 AATTCAGGATGTTTCTGGAAAGG - Intergenic
997159039 5:131587876-131587898 AGGCCAAGAAAAATCTGGAAAGG + Intronic
999085141 5:148881582-148881604 ATGCCAGGACTTTTCTAGAATGG - Intergenic
1001009392 5:168084537-168084559 AGGTCATGATATTTATGCAAAGG + Intronic
1003086768 6:3066615-3066637 AGTCCAGGATGTTTGTGGAAGGG - Intronic
1003122464 6:3329417-3329439 AGTACAGGATTTTTCTGGACTGG + Intronic
1003678623 6:8230184-8230206 CTGCCAGGATATTGCTGCAAAGG - Intergenic
1005380685 6:25231535-25231557 AGCCCAGGATTTTTCTGAAGAGG + Intergenic
1005608960 6:27504895-27504917 AGGCCAGGAGATTGAAGGAATGG - Intergenic
1007746142 6:44044026-44044048 TGGCCTGGATTTTTCTGGAGGGG - Intergenic
1008999706 6:57699460-57699482 AGGTCAGGATAGTGCTGGGAGGG + Intergenic
1009188189 6:60598882-60598904 AGGTCAGGATAGTGCTGGGAGGG + Intergenic
1012064255 6:94529383-94529405 AGCCCAGTATGTTTCTGGACAGG - Intergenic
1013645755 6:112139278-112139300 AGGCCAGCTTATCTCTGAAATGG + Exonic
1013817114 6:114111911-114111933 AGGTCAGAAAATTTCTGGAGTGG - Intronic
1013938761 6:115634174-115634196 AGGCCAAAATATTTTTGGGAAGG - Intergenic
1016275566 6:142348219-142348241 AGGACAGTATATTTCTAAAATGG + Intronic
1016669428 6:146684940-146684962 AGCCCAGTATATGTCTAGAATGG - Intronic
1017748561 6:157468983-157469005 AGGAGATGATATTTCTGGGAGGG + Intronic
1019514739 7:1434742-1434764 AGGGAAGGATGTTTCTGGCAGGG - Intronic
1019935742 7:4256312-4256334 AGGCCAGGATATTTCTGGAATGG - Intronic
1022611492 7:31878995-31879017 AGGCTGGGATATTTGTGGAGAGG - Exonic
1022662242 7:32377984-32378006 AGGAGAGACTATTTCTGGAAGGG + Intergenic
1024234177 7:47385405-47385427 AGGCCAGGACAGGGCTGGAATGG - Intronic
1024757686 7:52555251-52555273 AGGGCAGTAATTTTCTGGAAAGG - Intergenic
1026617796 7:71921849-71921871 TGGCCAGGATGTGTCTGGGAAGG - Intronic
1027162328 7:75811812-75811834 TTGCCAGGATATCTCTGGACAGG + Exonic
1029455034 7:100665435-100665457 GGGCCAGGATATTCAGGGAAGGG + Intergenic
1035450804 7:158975814-158975836 AGCACAGGATATTTTTGGGACGG + Intergenic
1036957894 8:13210313-13210335 AGACCAGGATATTTATTAAAGGG + Intronic
1038095757 8:24308024-24308046 AGTCCTGGATGTTTCTGGGATGG - Intronic
1038345265 8:26726480-26726502 AGGCCAGAATATTGCTCTAATGG + Intergenic
1040005034 8:42613195-42613217 AGGACATGATACTTCTGGTATGG - Intergenic
1040296065 8:46149719-46149741 AGCCCAGGGGACTTCTGGAAGGG + Intergenic
1040309896 8:46231480-46231502 AGCCCTGGGTACTTCTGGAATGG - Intergenic
1041319500 8:56598784-56598806 AGGCGAGGATATTGGTGGGATGG - Intergenic
1043035777 8:75197085-75197107 AGTCCAAGATATATCTGGTAGGG + Intergenic
1044331661 8:90927498-90927520 ATGCCAGGATATTTGTGCACAGG + Intronic
1045155181 8:99460597-99460619 AGGACAAGGTATTTCTGGTAAGG + Intronic
1048081587 8:131134088-131134110 AGGCCAAGATGTTGCTGTAATGG - Intergenic
1049733371 8:144190684-144190706 AGGCCGTGGGATTTCTGGAAGGG + Intronic
1050084994 9:1955626-1955648 AGGCAAGGATTTTTTTGGATAGG + Intergenic
1052003058 9:23311202-23311224 AGTCCACCATCTTTCTGGAATGG + Intergenic
1052153901 9:25157645-25157667 AGACTATGATATTTGTGGAAGGG + Intergenic
1052261582 9:26522546-26522568 AGGGCAGTATGTTCCTGGAATGG + Intergenic
1053706196 9:40754622-40754644 AGGCCAGCATCTTTGGGGAAAGG - Intergenic
1054416272 9:64878227-64878249 AGGCCAGCATCTTTGGGGAAAGG - Intergenic
1054750064 9:68896783-68896805 AGGAAAGCCTATTTCTGGAATGG + Intronic
1056279215 9:85023523-85023545 AGGCCAGCATATAACTTGAATGG - Exonic
1056990317 9:91404633-91404655 ACACAAGGATATCTCTGGAAAGG - Intergenic
1059462368 9:114441470-114441492 AGGCCATGATATTTCTCAATGGG - Intronic
1060230597 9:121822589-121822611 AGGACAGGGTATGTCTGGGATGG + Exonic
1061118695 9:128630043-128630065 AGGCCAGGATGACTCAGGAATGG - Intronic
1186062092 X:5719859-5719881 AGCCCAGGTTTTTTCTGAAAAGG + Intergenic
1186470806 X:9820813-9820835 AGGCCAGCAGACTTCTGTAAAGG + Intronic
1186482183 X:9904465-9904487 AGGGCTGGATTCTTCTGGAAAGG - Intronic
1187279685 X:17848581-17848603 AGGCCAGGGAAGGTCTGGAAAGG - Intronic
1188302595 X:28524149-28524171 TGTCCAGGATGTTCCTGGAAGGG + Intergenic
1190441290 X:50476904-50476926 AGGCATGGCCATTTCTGGAAGGG + Intergenic
1193420964 X:81281336-81281358 AGGCGAAGATCTTTTTGGAATGG - Intronic
1193980989 X:88181384-88181406 AGTCTCGGATATTTCAGGAATGG + Intergenic
1195911389 X:109891508-109891530 AGTCCGGGAATTTTCTGGAATGG - Intergenic
1196126643 X:112108695-112108717 AGGCCAGCATAGCTCTGGGATGG + Intergenic
1196179263 X:112672154-112672176 AGGAGAGGTTATCTCTGGAATGG + Intronic
1196785570 X:119418879-119418901 AGGCCAGGCTATACCTGGAAGGG - Intronic
1198642614 X:138773308-138773330 AGATCAGCATTTTTCTGGAAGGG - Intronic
1200409331 Y:2845964-2845986 AGGACAAGATATTTCTGTACAGG + Intronic
1201306083 Y:12551869-12551891 AGGGCTGGATTCTTCTGGAAAGG - Intergenic
1201944603 Y:19498134-19498156 AGGCAAAAATATTTCTGAAAAGG + Intergenic
1201990306 Y:20016523-20016545 AAGCCAGGACATTTCTGTGAAGG + Intergenic