ID: 1019935743

View in Genome Browser
Species Human (GRCh38)
Location 7:4256317-4256339
Sequence CATGAAGGCCAGGATATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019935743_1019935751 9 Left 1019935743 7:4256317-4256339 CCAGAAATATCCTGGCCTTCATG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1019935751 7:4256349-4256371 TCTGATATTCAGAGGGGACTGGG No data
1019935743_1019935747 1 Left 1019935743 7:4256317-4256339 CCAGAAATATCCTGGCCTTCATG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1019935747 7:4256341-4256363 CTAGTAACTCTGATATTCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 127
1019935743_1019935752 20 Left 1019935743 7:4256317-4256339 CCAGAAATATCCTGGCCTTCATG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1019935752 7:4256360-4256382 GAGGGGACTGGGAAGAAATGTGG 0: 1
1: 1
2: 5
3: 68
4: 702
1019935743_1019935754 27 Left 1019935743 7:4256317-4256339 CCAGAAATATCCTGGCCTTCATG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1019935754 7:4256367-4256389 CTGGGAAGAAATGTGGGCTTTGG No data
1019935743_1019935748 2 Left 1019935743 7:4256317-4256339 CCAGAAATATCCTGGCCTTCATG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1019935748 7:4256342-4256364 TAGTAACTCTGATATTCAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1019935743_1019935753 21 Left 1019935743 7:4256317-4256339 CCAGAAATATCCTGGCCTTCATG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1019935753 7:4256361-4256383 AGGGGACTGGGAAGAAATGTGGG No data
1019935743_1019935749 3 Left 1019935743 7:4256317-4256339 CCAGAAATATCCTGGCCTTCATG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1019935749 7:4256343-4256365 AGTAACTCTGATATTCAGAGGGG No data
1019935743_1019935750 8 Left 1019935743 7:4256317-4256339 CCAGAAATATCCTGGCCTTCATG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1019935750 7:4256348-4256370 CTCTGATATTCAGAGGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019935743 Original CRISPR CATGAAGGCCAGGATATTTC TGG (reversed) Intronic
901949820 1:12734712-12734734 AATGGAGGCAAGGATATTTGAGG - Intergenic
902438963 1:16416776-16416798 CTTGAAGGCCATCCTATTTCTGG - Intronic
903512938 1:23890058-23890080 CATGTTGGCCAGGCTATTCCTGG - Intronic
904962471 1:34345107-34345129 CAGGATGGTAAGGATATTTCAGG - Intergenic
907735105 1:57104680-57104702 CATGAAGTCCAGGTTGTTTTGGG - Intronic
908347366 1:63248727-63248749 CCTGAAGGTCAGTATATTTTAGG - Intergenic
911516533 1:98874624-98874646 CTTCAAGGACAGGATGTTTCTGG - Intergenic
912332011 1:108828507-108828529 CATTTATGCCAGGATATCTCGGG - Intronic
915170492 1:153973878-153973900 CTTGTGGGTCAGGATATTTCTGG - Exonic
917349982 1:174066939-174066961 CATGAAATCCATGACATTTCTGG + Intergenic
918843151 1:189571550-189571572 TATGTAGGCCAGGACATTTTTGG - Intergenic
921960425 1:221028061-221028083 CAACAAGGCCAGGAGCTTTCTGG - Intergenic
1070187513 10:74079467-74079489 CATGTAGGTCTGTATATTTCAGG - Intronic
1071411687 10:85403116-85403138 GATGGAGGTCAGGCTATTTCTGG - Intergenic
1075312675 10:121427999-121428021 CATCAAAGCCAGTTTATTTCTGG - Intergenic
1078940821 11:16003308-16003330 CAAGATGGCCAGGTAATTTCAGG - Intronic
1080062444 11:27971329-27971351 CAGGAAGTCCAGGACATTTTGGG - Intergenic
1085676471 11:78524423-78524445 CATGAAGTCAAGCATATTTTAGG - Intronic
1092918073 12:13206246-13206268 AAGAAAGGCCAGGATTTTTCTGG - Intronic
1093521227 12:20052387-20052409 GAGTAATGCCAGGATATTTCAGG + Intergenic
1093872120 12:24305412-24305434 CATCAAGACCCTGATATTTCAGG - Intergenic
1094648235 12:32348636-32348658 CATGAGGCCCAGGACATTCCAGG + Intronic
1097401169 12:59129622-59129644 CATGAAGGACTGGCTCTTTCAGG + Intergenic
1098389488 12:69953926-69953948 CTTGAAGCCCAGGTTATATCAGG - Intronic
1098563703 12:71907060-71907082 TATGAAGGCCAAGATAATCCAGG + Exonic
1098903461 12:76137149-76137171 CATGAAGGCAAGGAGATTCCGGG + Intergenic
1105461258 13:20590630-20590652 CATGAAGGGCTAGATATTTTAGG + Intronic
1105823041 13:24096831-24096853 CATGCAGGCCAGATCATTTCAGG + Intronic
1108493735 13:51005058-51005080 CAGGAAGGCCAGGAACTCTCAGG - Intergenic
1110638083 13:77789619-77789641 CATGCAGGGAAGGATATTTTGGG + Intergenic
1117493904 14:56282064-56282086 CATGTAGGTAAGGATATCTCTGG - Intronic
1119432602 14:74578263-74578285 CAGGTAGGCCAAGAGATTTCAGG + Intronic
1119551001 14:75514171-75514193 CTTGAAGCTCAGGAAATTTCCGG - Intergenic
1120514443 14:85453485-85453507 CATGTATACTAGGATATTTCTGG + Intergenic
1121962373 14:98273459-98273481 CAGGAATGGCAGGAAATTTCAGG - Intergenic
1121985413 14:98500867-98500889 CATGAAGTCCGGGATTTCTCTGG - Intergenic
1124809425 15:32920090-32920112 AATGAATGCCAGGAGGTTTCTGG + Intronic
1127144040 15:56006904-56006926 CATGAAGTTCAGTAGATTTCGGG + Intergenic
1127519284 15:59727399-59727421 CAAGGAGGAAAGGATATTTCAGG - Intergenic
1133654928 16:7851876-7851898 GATGAAGGCAAGGCCATTTCTGG - Intergenic
1137567207 16:49540801-49540823 CATGGAGGCCAGGATAGGGCTGG - Intronic
1137874487 16:51982931-51982953 AATGAAGGCGAGGATTTGTCAGG - Intergenic
1138935678 16:61719145-61719167 CTTTAAGGCAAGGATGTTTCAGG - Intronic
1140204865 16:72925428-72925450 CCTGAATGCCAGGAAATTTCAGG + Intronic
1145925065 17:28640739-28640761 CATAGAGGCCAGGGCATTTCGGG - Intronic
1151281047 17:73074264-73074286 CATGAAGTCAGGGATATTTCAGG - Intronic
1157816336 18:50731909-50731931 CATGAAGGCCACTGTATTTGGGG + Intergenic
1158502650 18:58017431-58017453 CTGGAAGGCAAGGCTATTTCTGG + Intergenic
1159013886 18:63085647-63085669 CATGTTGACCAGGAGATTTCAGG + Intergenic
1162959263 19:14116866-14116888 CATGGGGGACAGGATCTTTCTGG - Intronic
1167253537 19:48414308-48414330 CATGGAGGCCAGGATACACCGGG + Intronic
925712061 2:6750699-6750721 TTTGAATGCCAGGATATTTCTGG + Intergenic
926694388 2:15761043-15761065 CATGCGGGCCAGGGGATTTCAGG - Intergenic
927972728 2:27315955-27315977 CAAGGAGGCCAGGGTATTCCTGG + Intronic
929410457 2:41693249-41693271 CAAGAAAGCCAGGAACTTTCTGG + Intergenic
929644907 2:43616620-43616642 CATGAAGGCCTGGCTATTTTAGG + Intergenic
929650469 2:43675632-43675654 CATGAACTCCTGCATATTTCAGG + Intronic
933469375 2:82701634-82701656 CATTTAAGCCAGGATAATTCAGG + Intergenic
934547112 2:95226951-95226973 CATGCAAGGCAGGAAATTTCTGG + Intronic
937122915 2:119453074-119453096 CAGGAAGGCCAGGACAGTGCAGG + Intronic
937440781 2:121913810-121913832 CATGAAGTCAAGGATATTATGGG + Intergenic
939272494 2:139958910-139958932 CATTTATGCCAAGATATTTCGGG - Intergenic
940693130 2:156944876-156944898 CAAGAAGTCCTTGATATTTCAGG - Intergenic
941145522 2:161839583-161839605 CATGAAGTCCAGTATAATTGGGG - Intronic
941941168 2:171039587-171039609 CATGAAGGCCAGCAAATTCCAGG - Intronic
945587016 2:211678627-211678649 AATGCAGGCCAGGATTTTTAAGG - Intronic
946164604 2:217856347-217856369 CACCAATGCCAGGATGTTTCAGG - Intronic
946292628 2:218756790-218756812 AATGAAGTGCAGGCTATTTCTGG + Intergenic
1174119676 20:48253691-48253713 CAGGAAGGCCTGGATGCTTCAGG + Intergenic
1178071616 21:28974644-28974666 AAAGAAGGCCAGGATAATGCGGG + Intronic
1178772073 21:35514791-35514813 CCTGAAGCCCTGGATGTTTCTGG + Intronic
1180137676 21:45871709-45871731 CATGGCGGCCACGATCTTTCTGG + Intronic
949878619 3:8644080-8644102 CATGAAGGAAATGGTATTTCAGG - Intronic
953075959 3:39570567-39570589 CATGAAGACCAAGATATGCCTGG + Intergenic
957149509 3:76467679-76467701 CATAAAGCCCAGTATACTTCAGG - Intronic
957197369 3:77086749-77086771 CATGAAGGCTATAATTTTTCTGG + Intronic
960623020 3:119654433-119654455 CATGGAGGCACGGATATTGCTGG + Intronic
960889473 3:122432312-122432334 CATCATGGGCAGGTTATTTCAGG - Intronic
960954505 3:123022304-123022326 GATGCTGGCCAGGACATTTCTGG + Intronic
961039151 3:123664530-123664552 GAGGGAGACCAGGATATTTCTGG - Intronic
961235957 3:125367787-125367809 CATGAAGGCCAAGTAATTTGTGG + Intronic
961840871 3:129710787-129710809 CACTAAGTCCAGGATATTTGTGG + Intronic
962194709 3:133351472-133351494 CATGAAGCACAGGCTTTTTCTGG + Intronic
962324633 3:134423045-134423067 CCTGAAGGTCAGGACAGTTCAGG - Intergenic
962342888 3:134600185-134600207 CAGGCAGACCAGGATATCTCAGG + Intronic
963491235 3:146003410-146003432 CCTGAAGGCCAGAAAATTTGTGG + Intergenic
965207120 3:165735429-165735451 CATGAATGGCAGGATTTTTGGGG - Intergenic
967242672 3:187456436-187456458 CCTGAAGTCCAGGAAATGTCTGG - Intergenic
969094613 4:4722879-4722901 AATGAAAGCCAAGATATATCAGG - Intergenic
971264552 4:25086299-25086321 CATGAAGGCCGTACTATTTCAGG - Intergenic
976331703 4:83839224-83839246 CATGAAGGCCAATCTATTTCTGG - Intergenic
978558749 4:110009193-110009215 GAAGAAGGCCTGGATATTTAAGG + Intronic
978582591 4:110247145-110247167 CATGGAAGCAGGGATATTTCAGG + Intergenic
978743967 4:112170792-112170814 TATGAAGGCAAGAAAATTTCAGG + Intronic
984694303 4:182764246-182764268 AATGAATGCCAGGAAATTACGGG - Intronic
984934751 4:184880453-184880475 CTGGAAGTCCAGGATAGTTCAGG + Intergenic
986182412 5:5405586-5405608 TGTGATTGCCAGGATATTTCTGG + Intergenic
986280118 5:6315804-6315826 CATGAGGGGCAGGACATTTGTGG - Intergenic
987292095 5:16518976-16518998 TATCAAACCCAGGATATTTCTGG + Intronic
987424835 5:17761012-17761034 GAATAAGGACAGGATATTTCAGG + Intergenic
988126709 5:27048999-27049021 CAAGAAAACCAGGATATTTAGGG - Intronic
988131365 5:27110743-27110765 AATGAAGCCCAGTAGATTTCAGG + Intronic
989564819 5:42891782-42891804 CATGCAGGCTAGGATAATTTCGG - Intergenic
990372001 5:55129468-55129490 CAAAAAGGCCACCATATTTCTGG + Intronic
992561021 5:77953057-77953079 CATAAAGCACAGGATGTTTCTGG - Intergenic
994557947 5:101328944-101328966 CATGAAGAACTGCATATTTCAGG - Intergenic
995883386 5:116867263-116867285 CATGTTGGCCAGGATGTTTCTGG + Intergenic
996810219 5:127508136-127508158 CAAGAGGGGCAGGATATTTTGGG + Intergenic
1004834360 6:19514781-19514803 GAAAAAGGCCAGGATATTTTAGG - Intergenic
1008048135 6:46872675-46872697 CATGGAGGGCATGGTATTTCTGG - Intronic
1008116336 6:47554745-47554767 CATGAAGCCCAGGACGATTCAGG + Exonic
1011125872 6:84006955-84006977 CAAGAAGGCATAGATATTTCTGG + Intergenic
1011401660 6:86969411-86969433 CATGAACTCCAGGACTTTTCTGG + Intronic
1015207015 6:130651355-130651377 CATGTTGGCCAGGATGTTCCCGG - Intergenic
1018973009 6:168541566-168541588 CCTGGAGGCCAGGATCTTACAGG + Intronic
1019935743 7:4256317-4256339 CATGAAGGCCAGGATATTTCTGG - Intronic
1020571835 7:9872903-9872925 CGTCAAGGTCAGGATATTTTGGG + Intergenic
1021077409 7:16322013-16322035 CATCAGGGCTAGGATCTTTCTGG - Intronic
1026109356 7:67446536-67446558 CCTGCACCCCAGGATATTTCTGG - Intergenic
1026583519 7:71637384-71637406 CATGTTGGCCAGAATTTTTCTGG + Intronic
1027833153 7:83206578-83206600 AAGGGAGGCCAGGATATTCCTGG - Intergenic
1032345086 7:131109746-131109768 AGTGAGGGCCAGGACATTTCAGG - Intergenic
1034338729 7:150339218-150339240 CATGCAGGCCAGCAGGTTTCAGG + Intronic
1034902853 7:154918172-154918194 CCTGAACACCAGGATATTTTTGG - Intergenic
1036704372 8:11035617-11035639 CATGCAAAACAGGATATTTCAGG - Intronic
1037322033 8:17652965-17652987 GATGAAGTCCAGGATGTTTCTGG - Intronic
1037906959 8:22721192-22721214 CAGGGAGGCCAGGACATTCCGGG + Intronic
1043947309 8:86268961-86268983 CATGAAAGCCAGGATATGCTGGG - Intronic
1047693278 8:127378206-127378228 GATGAAAGCCAGGAACTTTCTGG + Intergenic
1047817809 8:128483941-128483963 TCTGAAGGCCCTGATATTTCAGG + Intergenic
1052493873 9:29201277-29201299 CATGAACGCATGGATATTTTAGG + Intergenic
1054944174 9:70776933-70776955 CATCAAAGTCAGGATATTTAGGG + Intronic
1059057180 9:110996111-110996133 CATGTAGGACAGCATCTTTCAGG - Intronic
1059608931 9:115870428-115870450 CATGATGGCCATGACATTTTAGG - Intergenic
1061190969 9:129082434-129082456 CAGGAATGCAGGGATATTTCAGG - Intronic
1062398635 9:136362929-136362951 CAGGGAGGCCAGGGTACTTCTGG + Intronic
1185845178 X:3431100-3431122 CAAGAAGTCAAGGATATTTTGGG - Intergenic
1188908569 X:35818112-35818134 AATGAAGCCCAGTATTTTTCAGG + Intergenic
1190755206 X:53395513-53395535 CATGATGCCCAGAACATTTCTGG + Intronic
1191939465 X:66462798-66462820 AATGAAGGCCTGGAACTTTCTGG - Intergenic
1192044430 X:67657200-67657222 CAAGGATACCAGGATATTTCAGG + Intronic
1192194146 X:69017486-69017508 GGTGAAGGCCAGGAGATCTCAGG - Intergenic
1192404400 X:70869802-70869824 CACAAGGACCAGGATATTTCAGG - Intronic
1193335381 X:80281989-80282011 CATGAAGGGCTGTTTATTTCAGG - Intergenic
1196624241 X:117860005-117860027 CATGAAGGCAGGGCTTTTTCTGG - Intergenic
1199669321 X:150129324-150129346 CATGGAAACCTGGATATTTCAGG + Intergenic
1201885448 Y:18876706-18876728 CAAGAAACCCAGGATGTTTCTGG + Intergenic