ID: 1019935745

View in Genome Browser
Species Human (GRCh38)
Location 7:4256327-4256349
Sequence AGTTACTAGCCATGAAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 81}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019935745_1019935748 -8 Left 1019935745 7:4256327-4256349 CCTGGCCTTCATGGCTAGTAACT 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1019935748 7:4256342-4256364 TAGTAACTCTGATATTCAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1019935745_1019935752 10 Left 1019935745 7:4256327-4256349 CCTGGCCTTCATGGCTAGTAACT 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1019935752 7:4256360-4256382 GAGGGGACTGGGAAGAAATGTGG 0: 1
1: 1
2: 5
3: 68
4: 702
1019935745_1019935747 -9 Left 1019935745 7:4256327-4256349 CCTGGCCTTCATGGCTAGTAACT 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1019935747 7:4256341-4256363 CTAGTAACTCTGATATTCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 127
1019935745_1019935754 17 Left 1019935745 7:4256327-4256349 CCTGGCCTTCATGGCTAGTAACT 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1019935754 7:4256367-4256389 CTGGGAAGAAATGTGGGCTTTGG No data
1019935745_1019935753 11 Left 1019935745 7:4256327-4256349 CCTGGCCTTCATGGCTAGTAACT 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1019935753 7:4256361-4256383 AGGGGACTGGGAAGAAATGTGGG No data
1019935745_1019935750 -2 Left 1019935745 7:4256327-4256349 CCTGGCCTTCATGGCTAGTAACT 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1019935750 7:4256348-4256370 CTCTGATATTCAGAGGGGACTGG No data
1019935745_1019935755 22 Left 1019935745 7:4256327-4256349 CCTGGCCTTCATGGCTAGTAACT 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1019935755 7:4256372-4256394 AAGAAATGTGGGCTTTGGCCTGG No data
1019935745_1019935751 -1 Left 1019935745 7:4256327-4256349 CCTGGCCTTCATGGCTAGTAACT 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1019935751 7:4256349-4256371 TCTGATATTCAGAGGGGACTGGG No data
1019935745_1019935749 -7 Left 1019935745 7:4256327-4256349 CCTGGCCTTCATGGCTAGTAACT 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1019935749 7:4256343-4256365 AGTAACTCTGATATTCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019935745 Original CRISPR AGTTACTAGCCATGAAGGCC AGG (reversed) Intronic
901545206 1:9951162-9951184 AGTTACTTGCCTCGAAGGACTGG + Intronic
901878407 1:12180132-12180154 ATTGAAAAGCCATGAAGGCCGGG + Intronic
904903497 1:33876343-33876365 ACTTACTAGCCATGTGGCCCTGG + Intronic
905759496 1:40542662-40542684 AATTAGTTACCATGAAGGCCAGG - Intronic
907888161 1:58612952-58612974 AGTTCCTAGCCATGATGGAATGG + Intergenic
908217671 1:61971184-61971206 ACTTTCTAGCCATGAAATCCTGG - Intronic
914422388 1:147541426-147541448 AGCTACTTGGCATGAATGCCTGG + Exonic
915288115 1:154865690-154865712 AGTAACTTGTCATGCAGGCCTGG - Intronic
915466154 1:156099204-156099226 AGCTACTAGCCTTCTAGGCCTGG + Intronic
919664399 1:200278431-200278453 AGTTACTGGGCATGTATGCCAGG + Intergenic
923372803 1:233328959-233328981 ACTTCCGAGCCCTGAAGGCCTGG - Intronic
1063371446 10:5525288-5525310 AGTTCCTGGGCATGATGGCCAGG + Exonic
1064180904 10:13113651-13113673 TGTTAGTAGCAATGAAGGACAGG - Intronic
1068739568 10:60453144-60453166 ATTTACTAGCTATGAAAGCCTGG + Intronic
1072862203 10:99018278-99018300 ACTTACTAGGCCTAAAGGCCAGG + Intronic
1073720707 10:106168044-106168066 GGTTCCCAGCCATAAAGGCCAGG - Intergenic
1078614958 11:12856365-12856387 AGTTACCAGCAAAGAAGCCCAGG + Intronic
1079872216 11:25813540-25813562 AATTACTAGCCTAGAATGCCTGG + Intergenic
1084817336 11:71656462-71656484 AGTTACAAGCCATGAGAACCTGG + Intergenic
1092019783 12:5191806-5191828 CGTCACAAGCCAGGAAGGCCGGG + Intergenic
1094005647 12:25747474-25747496 AGTTACTAGCTATGTAACCCTGG - Intergenic
1099223445 12:79940882-79940904 AGTTACTAGCAGTGAAGGGTGGG + Intergenic
1104552911 12:129773849-129773871 ACTTACTTGCCATGAAGACTTGG + Intronic
1106018437 13:25891642-25891664 AGTTAATAGGGATGAAGGCAGGG - Intronic
1107712985 13:43168948-43168970 AGTTCCTAGCCATGATGGGATGG - Intergenic
1107723139 13:43270541-43270563 AGTTCCTAACCATCAAAGCCTGG + Intronic
1119912278 14:78360536-78360558 ATTTACTACCCATGTAGCCCTGG + Intronic
1119958263 14:78824227-78824249 AGTTTCCAGCCATGATGGGCAGG - Intronic
1127290573 15:57566997-57567019 AGTCACGAGACATGCAGGCCTGG - Intergenic
1127582039 15:60347453-60347475 AGAGACTAGACAGGAAGGCCAGG + Exonic
1132138265 15:99366241-99366263 ATCTACAAGCCATGGAGGCCTGG - Intronic
1134694162 16:16210796-16210818 ATTTAATAGCCATTTAGGCCGGG + Intronic
1134977677 16:18583846-18583868 ATTTAATAGCCATTTAGGCCGGG - Intergenic
1136631323 16:31490696-31490718 AGTCACTTCCCATGAGGGCCTGG + Exonic
1141029706 16:80577043-80577065 ACTTACTAGCTATGAAGCCATGG + Intergenic
1144073489 17:11695499-11695521 AGTTACTAGCCATAGAGTCTTGG + Intronic
1145028422 17:19486591-19486613 AGTTACTCGCAATTAAGACCTGG + Intergenic
1149065716 17:52477336-52477358 AGTTACTGGCCATGATGGGAAGG + Intergenic
1153612057 18:6896052-6896074 AGTTAGCAGCCATGAATGGCTGG - Intronic
1158473050 18:57755613-57755635 AGTTATTATCCATGAATCCCAGG + Intronic
925841052 2:7992713-7992735 AGTTACAAGCCATGACTTCCGGG - Intergenic
927628776 2:24752108-24752130 AGTCACCAGACATGAAGGCCTGG + Exonic
930091084 2:47531882-47531904 AGTTACACCCCATGAAGGACTGG - Intronic
933821575 2:86117214-86117236 AAATATTAGCCATGAAAGCCTGG - Intronic
935378438 2:102423950-102423972 CGTTACTACCCATGAAGGGCAGG - Exonic
936688941 2:114863181-114863203 AGTTATTAGCCATCAAGGCATGG - Intronic
937346715 2:121130528-121130550 AGTTTCTAGCCAAGCAGGTCTGG + Intergenic
939892094 2:147748373-147748395 ACTTACTAGCCATGAAACACTGG + Intergenic
940177935 2:150900023-150900045 AATTACTAGCCATGCAGCCTTGG + Intergenic
942956459 2:181779888-181779910 AGTTACTAGCCTTGACAACCTGG + Intergenic
946798959 2:223389199-223389221 AGTTCCTAGCCACGAGGGCTTGG + Intergenic
947610647 2:231522947-231522969 AGATGCTGGCCAGGAAGGCCTGG - Intergenic
1169801993 20:9520183-9520205 AATTATTAGCCATAAAAGCCTGG - Intronic
1172625132 20:36342447-36342469 GGTTCCCAGCCTTGAAGGCCAGG + Intronic
1176342596 21:5712830-5712852 AGTTGCTAGCCATGAAGAACAGG - Intergenic
1176474850 21:7144981-7145003 AGTTGCTAGCCATGAAGAACAGG - Intergenic
1176502231 21:7611626-7611648 AGTTGCTAGCCATGAAGAACAGG + Intergenic
1176536917 21:8110899-8110921 AGTTGCTAGCCATGAAGAACAGG - Intergenic
1203241866 22_KI270733v1_random:27303-27325 AGTTGCTAGCCATGAAGAACAGG - Intergenic
951356256 3:21670730-21670752 AGTTCCCAGCCATGAAGGGATGG + Intronic
959781582 3:110240480-110240502 AGTTTCCAGCCATGAAGGGATGG - Intergenic
960397626 3:117156568-117156590 AGTTACTTGCCTTTAAGGCCCGG - Intergenic
962242278 3:133759779-133759801 AGTTGCTAGCCCTGAACTCCTGG - Intronic
963781480 3:149491116-149491138 AATTACTAGCCATGGAGCCCTGG - Intronic
965925302 3:173971713-173971735 AGTCACAAGGCATGAAGGACTGG + Intronic
968297161 3:197585491-197585513 AGTTACTAGAGATGAAGGGTTGG + Intergenic
970360075 4:15300406-15300428 AGATACCAGGCATGAAGACCTGG + Intergenic
972618712 4:40725070-40725092 AGTTACTAGCCATGTAACCTTGG - Intergenic
973274329 4:48292294-48292316 ACTTCCTAGACATGATGGCCAGG - Intergenic
974067450 4:57092421-57092443 AGTTACTAGCCATAAAACCAGGG - Intronic
974286595 4:59876914-59876936 AGTTACTAGCCATGCAATCTTGG + Intergenic
975399346 4:73916671-73916693 AATTGCTTGCCTTGAAGGCCTGG - Intergenic
976220718 4:82754854-82754876 AGTGACAAGCCTCGAAGGCCAGG + Intronic
976817040 4:89160855-89160877 ACTTATTAGCCATGAAGCCTTGG - Intergenic
980096180 4:128493259-128493281 ATTTACTAGCCATGTGGCCCTGG - Intergenic
981703311 4:147631986-147632008 AGAGACTAGCCATGTTGGCCAGG - Intronic
991047436 5:62237447-62237469 ACTTACTAGCCATGCAGTCAGGG + Intergenic
994275829 5:97836215-97836237 TTTTCCTAGCCAGGAAGGCCAGG - Intergenic
1003528800 6:6920566-6920588 AGTATTTAGCCATGATGGCCAGG + Intergenic
1007135100 6:39513081-39513103 AGTTTGTAGTCATGAAGACCTGG - Intronic
1016063114 6:139650784-139650806 AGTTCATAGCCATGTAGCCCAGG - Intergenic
1019356893 7:584892-584914 GGTTTCTAGCCATGAAGGGCAGG + Intronic
1019935745 7:4256327-4256349 AGTTACTAGCCATGAAGGCCAGG - Intronic
1026157541 7:67840232-67840254 AGTTACTACCCAGGAAGGAGGGG - Intergenic
1026988460 7:74569522-74569544 AGTTACTAGCTTTGCAGGCTAGG - Intronic
1027197369 7:76039940-76039962 AGGTACTAGCGATGGAGGCCAGG - Intronic
1036810862 8:11867232-11867254 GGTTAGTAGCCCTGGAGGCCGGG - Intronic
1037506617 8:19537056-19537078 AGTTCCTAGCCATGACAGCAAGG + Intronic
1038994989 8:32912544-32912566 AAAAACTAGCCATGTAGGCCTGG + Intergenic
1050358420 9:4804668-4804690 TTTGACTAGCCATGCAGGCCAGG - Intronic
1050797350 9:9560876-9560898 AGCTACTGACCATGAAGGCAAGG - Intronic
1060881458 9:127121058-127121080 ACTTACTAGCCATGTAGCCATGG + Intronic
1203458185 Un_GL000220v1:10380-10402 AGTTGCTAGCCATGAAGAACAGG - Intergenic
1185524595 X:767255-767277 AGTCACTTTCCATGAAGGACAGG - Intergenic
1190237950 X:48631913-48631935 AGCCACCAGCCATGAAGCCCAGG + Intergenic
1197481806 X:126995664-126995686 ATTTTCTAGGCATGAAGGCCTGG - Intergenic
1201354461 Y:13082716-13082738 ATTTACTAGCCATGATGGGAAGG - Intergenic