ID: 1019935746

View in Genome Browser
Species Human (GRCh38)
Location 7:4256332-4256354
Sequence ATCAGAGTTACTAGCCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019935746_1019935752 5 Left 1019935746 7:4256332-4256354 CCTTCATGGCTAGTAACTCTGAT 0: 1
1: 0
2: 1
3: 15
4: 142
Right 1019935752 7:4256360-4256382 GAGGGGACTGGGAAGAAATGTGG 0: 1
1: 1
2: 5
3: 68
4: 702
1019935746_1019935751 -6 Left 1019935746 7:4256332-4256354 CCTTCATGGCTAGTAACTCTGAT 0: 1
1: 0
2: 1
3: 15
4: 142
Right 1019935751 7:4256349-4256371 TCTGATATTCAGAGGGGACTGGG No data
1019935746_1019935753 6 Left 1019935746 7:4256332-4256354 CCTTCATGGCTAGTAACTCTGAT 0: 1
1: 0
2: 1
3: 15
4: 142
Right 1019935753 7:4256361-4256383 AGGGGACTGGGAAGAAATGTGGG No data
1019935746_1019935750 -7 Left 1019935746 7:4256332-4256354 CCTTCATGGCTAGTAACTCTGAT 0: 1
1: 0
2: 1
3: 15
4: 142
Right 1019935750 7:4256348-4256370 CTCTGATATTCAGAGGGGACTGG No data
1019935746_1019935755 17 Left 1019935746 7:4256332-4256354 CCTTCATGGCTAGTAACTCTGAT 0: 1
1: 0
2: 1
3: 15
4: 142
Right 1019935755 7:4256372-4256394 AAGAAATGTGGGCTTTGGCCTGG No data
1019935746_1019935754 12 Left 1019935746 7:4256332-4256354 CCTTCATGGCTAGTAACTCTGAT 0: 1
1: 0
2: 1
3: 15
4: 142
Right 1019935754 7:4256367-4256389 CTGGGAAGAAATGTGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019935746 Original CRISPR ATCAGAGTTACTAGCCATGA AGG (reversed) Intronic
901753014 1:11423290-11423312 AACTGAGTTATTGGCCATGATGG + Intergenic
903953467 1:27009936-27009958 ATCAGACTTTCCAGCCATGGAGG + Intronic
906913699 1:49983903-49983925 AACTGAGTTCCCAGCCATGACGG + Intronic
907888159 1:58612947-58612969 ACCTGAGTTCCTAGCCATGATGG + Intergenic
914973603 1:152334976-152334998 AACTGAGTTCCCAGCCATGATGG + Intergenic
915818514 1:158996086-158996108 AACTGAGTTTCTGGCCATGATGG - Intergenic
917189427 1:172398948-172398970 ATCAGAATTACTTAACATGAAGG - Intronic
918999758 1:191815261-191815283 AACTGAGTTCCTGGCCATGATGG + Intergenic
921996975 1:221430895-221430917 AACTGAGTTCCCAGCCATGATGG - Intergenic
922251560 1:223853771-223853793 ATCAGATTTACGAGAAATGATGG - Intergenic
1063521721 10:6747507-6747529 AACTGAGTTCCCAGCCATGATGG + Intergenic
1064474403 10:15671259-15671281 ATGAGAGGTACTAGAAATGAAGG + Intronic
1064737608 10:18398742-18398764 ATCAGAGATACAAGGAATGAAGG + Intronic
1065801635 10:29357786-29357808 AACTGAGTTCCTAGCCAGGATGG + Intergenic
1070972694 10:80580594-80580616 AACTGAGTTCCCAGCCATGATGG - Intronic
1070985586 10:80686992-80687014 AACTGAGTTCCCAGCCATGATGG + Intergenic
1073980143 10:109144962-109144984 AGCTGAGTTCCTGGCCATGACGG + Intergenic
1075171766 10:120122001-120122023 ATCACAGTTTCTTGCCATGTGGG - Intergenic
1076430204 10:130396441-130396463 ATCTGAGTTCTTGGCCATGAGGG + Intergenic
1083410230 11:62487366-62487388 AGCAGAGCTCCTAACCATGAGGG + Intronic
1088878451 11:113955056-113955078 CTCAGAGTTTCTGGCCTTGAAGG + Intergenic
1089123670 11:116161116-116161138 ATGAGAGGCACTAGCCATCAGGG + Intergenic
1089274298 11:117323832-117323854 TTCAACGTTACTAACCATGAGGG - Intronic
1090825107 11:130379666-130379688 ATCTAAGTTCCTGGCCATGATGG + Intergenic
1093189802 12:16060786-16060808 AACAGAGTTTCATGCCATGAAGG + Intergenic
1094111671 12:26869265-26869287 AACAAAGTTGCCAGCCATGATGG - Intergenic
1099891818 12:88598323-88598345 ATTTGAGTTACTAGCCATGATGG - Intergenic
1101101775 12:101401064-101401086 ATCAGAGTTAGTTGCCATGTTGG - Exonic
1102157065 12:110738951-110738973 ATCAGAGTTCTTATCAATGAGGG + Intronic
1107712987 13:43168953-43168975 AACTGAGTTCCTAGCCATGATGG - Intergenic
1116649755 14:47574613-47574635 AGCAGTGGTACTAGACATGAAGG - Intronic
1116855726 14:49950793-49950815 AGCAGAGTGATTGGCCATGAGGG + Intergenic
1117769376 14:59117680-59117702 AACTGAGTTCCTGGCCATGATGG + Intergenic
1121401546 14:93682470-93682492 ATCAGATTTGCTAATCATGATGG - Intronic
1121502559 14:94449866-94449888 ATCATAGTCAATAGCCATGCTGG - Intronic
1126056249 15:44732612-44732634 AACTGAGTTCCTGGCCATGACGG + Intronic
1130730164 15:86483492-86483514 ATATGAGTTCCTGGCCATGATGG - Intronic
1143822903 17:9579009-9579031 AGCAGAGTTCCCAGCCTTGACGG - Intronic
1145224940 17:21120330-21120352 ATCAACATTACTAGCCATTAGGG - Intergenic
1146251929 17:31353917-31353939 ATCACAGTTACTAGCCACATAGG + Intronic
1147549697 17:41431392-41431414 CTCAAAGTCACTAGCCATAAGGG + Intergenic
1149065714 17:52477331-52477353 AACTGAGTTACTGGCCATGATGG + Intergenic
1150673803 17:67226404-67226426 TTCAGTGTTATTAGCCATTAGGG + Intronic
1158866261 18:61640262-61640284 AACTGAGTTCCCAGCCATGATGG - Intergenic
1163084175 19:14967436-14967458 AACTGAGTTCCTGGCCATGATGG + Intronic
1163480316 19:17551689-17551711 ATCAGAGTTAATAGAGATGTTGG - Intronic
1164625851 19:29727401-29727423 CACAGAGTTCCCAGCCATGATGG + Intergenic
1167620955 19:50560387-50560409 GCCACAGTTACTAGCCATGTTGG + Intronic
925019325 2:556252-556274 AGCTGAGTTCCTGGCCATGATGG + Intergenic
925312913 2:2899949-2899971 AACAGAGTTTCTGGCCACGAGGG + Intergenic
926033369 2:9612838-9612860 ATTAGAGTGACTGGTCATGAAGG + Intronic
927443431 2:23136646-23136668 CTGAGAATTAGTAGCCATGATGG - Intergenic
936688942 2:114863186-114863208 TTGAGAGTTATTAGCCATCAAGG - Intronic
939204766 2:139086740-139086762 CTCAGAGTCACTAACCATTAGGG - Intergenic
942339172 2:174925169-174925191 AACTGAATTCCTAGCCATGATGG + Intronic
942922845 2:181397713-181397735 ATCTGAGTTACTTGCAATGTGGG + Intergenic
943614921 2:190081910-190081932 AACTGAGTTCCCAGCCATGATGG + Intronic
946005819 2:216524111-216524133 TTCAGAGTTATTAGAGATGATGG - Intronic
947092731 2:226530849-226530871 AGCTGAAATACTAGCCATGATGG - Intergenic
1169228136 20:3868906-3868928 AGCACAGTAACCAGCCATGATGG + Exonic
1169410405 20:5364463-5364485 AACTGAGTTCCTGGCCATGATGG - Intergenic
1173343325 20:42174844-42174866 TTCAGAGATACTAGCCATAAAGG - Intronic
1173479333 20:43386819-43386841 ATGAGAGTTACTAGAAATAAGGG - Intergenic
1173502032 20:43561011-43561033 ATCAGAGTGACTAACCATCCTGG + Intronic
1177625622 21:23656039-23656061 TTCACAGTTATTAGCCAGGATGG + Intergenic
1177757801 21:25368382-25368404 AACTGAATTCCTAGCCATGATGG + Intergenic
1178345852 21:31827461-31827483 AACTGAGTTCTTAGCCATGATGG - Intergenic
1180670265 22:17547768-17547790 ATCAGAATCACTGGCCATGCTGG - Intronic
1181272589 22:21668227-21668249 AACTGAGTTCCTGGCCATGATGG + Intronic
1181402133 22:22656364-22656386 ATCAGAGTTTCTATATATGATGG + Intergenic
1183631839 22:39038051-39038073 AACTGAGTTCCCAGCCATGATGG + Intergenic
1183636758 22:39068442-39068464 AACTGAGTTCCTGGCCATGATGG + Intronic
1183637723 22:39074881-39074903 AACTGAGTTCCCAGCCATGATGG + Intronic
1184439514 22:44500251-44500273 AGCCGAGTTCCTGGCCATGATGG + Intergenic
949258525 3:2079370-2079392 ATCAGAATCACCTGCCATGATGG - Intergenic
949260009 3:2095134-2095156 AGCACAGTTAATTGCCATGAAGG - Intergenic
951356254 3:21670725-21670747 AACTGAGTTCCCAGCCATGAAGG + Intronic
953010600 3:39021889-39021911 AACTGAGTTATTGGCCATGATGG + Intergenic
953359382 3:42281391-42281413 AACTGAGTTCCTAGTCATGATGG + Intergenic
954963589 3:54589802-54589824 CTCAGTGTTCTTAGCCATGAAGG + Intronic
955527912 3:59839768-59839790 ATCACAGATACTAGAGATGAAGG + Intronic
956330707 3:68103899-68103921 CTCAGAGTTCCTACCTATGAAGG + Intronic
956490949 3:69771440-69771462 GTCAGAGTTAATAGCCTTAATGG + Intronic
957314739 3:78562601-78562623 CTCAGAGTCACTAACCATCAGGG - Intergenic
960878431 3:122319924-122319946 ATCAGAGGCAATAACCATGAAGG + Intergenic
963762690 3:149300156-149300178 AACTGAGTTCCTGGCCATGATGG + Intergenic
965097616 3:164254211-164254233 AACAGAATTACCAGCCATAATGG + Intergenic
966018460 3:175174634-175174656 ATGAGTGTTATTAACCATGAAGG + Intronic
966900489 3:184480672-184480694 AACCGAGTTCCTGGCCATGATGG - Intronic
967558530 3:190889894-190889916 ATGAGGATTACTAGCCATGTGGG - Intronic
968000135 3:195199841-195199863 ATTAGACTTATGAGCCATGATGG + Intronic
970461726 4:16281066-16281088 AACTGAGTTCCTGGCCATGATGG + Intergenic
973581001 4:52344146-52344168 AACTGAGTTCCCAGCCATGATGG + Intergenic
973925182 4:55729832-55729854 AACTGAGTTCCCAGCCATGACGG + Intergenic
978737522 4:112100749-112100771 AACTGAGTTCCCAGCCATGATGG - Intergenic
980916329 4:139036463-139036485 ATGAGAGTGGCTACCCATGATGG + Intronic
980941998 4:139283661-139283683 AACTGAGTTCCTGGCCATGATGG + Intronic
981130785 4:141156132-141156154 AACAGGGTTTCCAGCCATGATGG - Intronic
983470716 4:168151010-168151032 AACTGAGTTCCTAGCAATGATGG - Intronic
986767567 5:10941471-10941493 AACTGAGTTCCTGGCCATGATGG + Intergenic
987166582 5:15204349-15204371 ATCAGAGTTACTTGTCTTCAAGG - Intergenic
987176871 5:15320989-15321011 AGCAGATTTACTAGCCAGTAGGG + Intergenic
988784985 5:34558243-34558265 ATCACAGCTGCTAGCCCTGAAGG + Intergenic
988816922 5:34843246-34843268 ATCAGAATTCCTATTCATGATGG + Intronic
990891245 5:60652552-60652574 AACTGAGTTCCTAGCCATGATGG - Intronic
992974292 5:82097670-82097692 ATCAAAGATGCTAGCCATTAGGG + Intronic
995619553 5:114009078-114009100 ATCAAAGTCTCTAGCCATGCAGG - Intergenic
997158550 5:131583221-131583243 AACTGAGTTCCCAGCCATGATGG + Intronic
997425070 5:133797584-133797606 ATCTGAGTTATTGGCCATGACGG - Intergenic
999516773 5:152309857-152309879 ATTGGAGTTTCTAGCCATGATGG - Intergenic
1000589753 5:163144271-163144293 AGCAGAGTTCCCAGCCATGATGG - Intergenic
1000801837 5:165737197-165737219 ATCAGGGTCACTATCCATGATGG + Intergenic
1007057043 6:38896750-38896772 ATTAGACTTACTAGCTAAGAAGG + Intronic
1008117531 6:47569352-47569374 ATCAGAGTTAGTAGGCTTAATGG + Intronic
1011809365 6:91112805-91112827 AACTGAGTTACTGGCCATGATGG + Intergenic
1013083025 6:106829441-106829463 AACCGAGTTCCCAGCCATGATGG + Intergenic
1013092373 6:106911930-106911952 ACCTGAGTTCCTGGCCATGATGG - Intergenic
1013811674 6:114051832-114051854 AGCAAAGCTACTGGCCATGAAGG + Intergenic
1014421086 6:121245980-121246002 GTCAGAGGTCCCAGCCATGATGG - Intronic
1014796471 6:125730773-125730795 ATCTGAGTTACTAGGTTTGAAGG + Intergenic
1015127592 6:129771679-129771701 AACTGAGTTTCCAGCCATGATGG + Intergenic
1016583060 6:145651011-145651033 ATCAGGGTTGCTATCCATGCAGG - Intronic
1018831876 6:167449456-167449478 AACTGAGTTCCTGGCCATGATGG + Intergenic
1019225821 6:170507102-170507124 AGCTGAGTTCCTGGCCATGATGG - Intergenic
1019356889 7:584887-584909 ACCCGGGTTTCTAGCCATGAAGG + Intronic
1019832209 7:3342934-3342956 TTCAGTATTACTAGCCATTAGGG + Intronic
1019935746 7:4256332-4256354 ATCAGAGTTACTAGCCATGAAGG - Intronic
1024766370 7:52665800-52665822 CTCAACGTTACTAGTCATGATGG - Intergenic
1026271634 7:68841902-68841924 AGCTGAGTTCCCAGCCATGATGG + Intergenic
1030556898 7:111037036-111037058 AGCAGTGTTACTAGCTAAGAGGG - Intronic
1031337915 7:120559869-120559891 ATCAAAGTTACTATTCATTAAGG - Intronic
1031551482 7:123119166-123119188 ATCAGAATTATTAGCCATGCTGG + Exonic
1033418213 7:141183094-141183116 ATCAGGAATACTAGCCATTAAGG - Intronic
1034659076 7:152753511-152753533 AGCTGAGTTCCTAGCCATAATGG - Intergenic
1036958650 8:13218524-13218546 CTCAGGGTTACTAGCCATTAGGG + Intronic
1037115621 8:15222468-15222490 ATCAGATTTGCTAGCCAAGCAGG - Intronic
1041720336 8:60969555-60969577 AACTGAGTTCCTGGCCATGATGG - Intergenic
1043391531 8:79796784-79796806 TCCTGAGTTACTAGCCATGAGGG - Intergenic
1045537024 8:103040002-103040024 ACCAAATTTACTAGCCATGTAGG + Intronic
1047972180 8:130094635-130094657 ATTAAAGTCACAAGCCATGAGGG + Intronic
1050918553 9:11168466-11168488 AGCTGAGTTCCTGGCCATGATGG + Intergenic
1052721093 9:32171899-32171921 AACTGAGTTCCTGGCCATGATGG - Intergenic
1056911283 9:90703139-90703161 AACTGAGTTCCTGGCCATGATGG - Intergenic
1058038293 9:100276971-100276993 ATCACATATACTAGCCAGGAAGG - Intronic
1060126969 9:121056751-121056773 TTAAGAGTTACTAGCCTTAAAGG + Intergenic
1062145777 9:134988931-134988953 AGCACAGTGCCTAGCCATGAGGG + Intergenic
1187491028 X:19751431-19751453 ACCAGAATTACAGGCCATGAGGG + Intronic
1193679814 X:84504430-84504452 ATCAGAGTCCCTACCCTTGAAGG + Intergenic
1193886592 X:86989505-86989527 TTCAGCGTTACTACCCATCAGGG + Intergenic
1194226567 X:91267126-91267148 TTCACCGTTACTAGCCATGAGGG - Intergenic
1194285520 X:92006219-92006241 TTAAGAGTTATTAGCCTTGAAGG - Intronic
1194290924 X:92071099-92071121 ATAAGAGTTACTGGCCTTGCCGG - Intronic
1196223173 X:113135856-113135878 AACTGAATTCCTAGCCATGATGG - Intergenic
1196418204 X:115495770-115495792 ATCATACATTCTAGCCATGAGGG - Intergenic
1196911829 X:120491696-120491718 AACTGAGTTCCTGGCCATGATGG + Intergenic
1198190648 X:134300983-134301005 CTAAGAGTTATTAGCCTTGAAGG + Intergenic
1198617485 X:138475367-138475389 AACTGAGTTCCTGGCCATGATGG - Intergenic
1200603087 Y:5230757-5230779 TTAAGAGTTATTAGCCTTGAAGG - Intronic
1200608434 Y:5295674-5295696 ATAAGAGTTACTGGCCTTGCCGG - Intronic