ID: 1019935751

View in Genome Browser
Species Human (GRCh38)
Location 7:4256349-4256371
Sequence TCTGATATTCAGAGGGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019935742_1019935751 14 Left 1019935742 7:4256312-4256334 CCATTCCAGAAATATCCTGGCCT 0: 1
1: 1
2: 0
3: 22
4: 222
Right 1019935751 7:4256349-4256371 TCTGATATTCAGAGGGGACTGGG No data
1019935743_1019935751 9 Left 1019935743 7:4256317-4256339 CCAGAAATATCCTGGCCTTCATG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1019935751 7:4256349-4256371 TCTGATATTCAGAGGGGACTGGG No data
1019935745_1019935751 -1 Left 1019935745 7:4256327-4256349 CCTGGCCTTCATGGCTAGTAACT 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1019935751 7:4256349-4256371 TCTGATATTCAGAGGGGACTGGG No data
1019935740_1019935751 24 Left 1019935740 7:4256302-4256324 CCTCACATTGCCATTCCAGAAAT 0: 1
1: 0
2: 5
3: 27
4: 258
Right 1019935751 7:4256349-4256371 TCTGATATTCAGAGGGGACTGGG No data
1019935746_1019935751 -6 Left 1019935746 7:4256332-4256354 CCTTCATGGCTAGTAACTCTGAT 0: 1
1: 0
2: 1
3: 15
4: 142
Right 1019935751 7:4256349-4256371 TCTGATATTCAGAGGGGACTGGG No data
1019935739_1019935751 27 Left 1019935739 7:4256299-4256321 CCTCCTCACATTGCCATTCCAGA 0: 1
1: 0
2: 1
3: 31
4: 265
Right 1019935751 7:4256349-4256371 TCTGATATTCAGAGGGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019935751 Original CRISPR TCTGATATTCAGAGGGGACT GGG Intronic
No off target data available for this crispr