ID: 1019935811

View in Genome Browser
Species Human (GRCh38)
Location 7:4256855-4256877
Sequence AAAATGTCCTGGGGGATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019935811 Original CRISPR AAAATGTCCTGGGGGATAAA AGG (reversed) Intronic
902154101 1:14469699-14469721 AACATGTCCTGATGGATAACAGG + Intergenic
903110571 1:21129662-21129684 GAAATGTCCTGGGGGAGAAAAGG - Intronic
903312832 1:22473292-22473314 AAACTGTTCTAGTGGATAAAGGG + Intronic
903388235 1:22944039-22944061 TAAATTTCCTGGCAGATAAAGGG + Intergenic
907786016 1:57613594-57613616 AAAATATCCTGGGGAAGGAATGG - Intronic
908079361 1:60559452-60559474 ATAATGCACTGGGGGATGAAAGG + Intergenic
909154469 1:72054910-72054932 TAATTATCCTGGGGGATCAAAGG + Intronic
910299879 1:85694042-85694064 GAAATGTACAGGGGGAAAAAAGG + Intronic
912102614 1:106230522-106230544 AAAATGTCAAGGAGGATAGAAGG + Intergenic
913611446 1:120513389-120513411 CAATTGCCCTGGGGGAAAAAAGG - Intergenic
913983347 1:143543433-143543455 CAATTGCCCTGGGGGAAAAAAGG + Intergenic
914416286 1:147486099-147486121 AATATGTGGTGGGGGATGAAGGG - Intergenic
914579746 1:149008850-149008872 CAATTGCCCTGGGGGAAAAAAGG + Intronic
915431288 1:155868837-155868859 AAAATATCTCAGGGGATAAATGG + Intronic
915687797 1:157652635-157652657 AACAGGTCCTGAGGGACAAAAGG + Intergenic
916422874 1:164652781-164652803 AAACTTTCCAGGGTGATAAAGGG - Intronic
917167069 1:172124401-172124423 AAAATATCCTGGTGGGTAACTGG - Intronic
918485073 1:185020262-185020284 GAAATCTCCTGGGAGAAAAATGG + Intergenic
918937314 1:190938721-190938743 AAGATGTGCTGGGTGATAGAGGG + Intergenic
921530659 1:216278413-216278435 CAAAGGTCCTGGGGTATAAATGG - Intronic
922071873 1:222203035-222203057 AAGATGTCCTGGAGGTTCAAAGG + Intergenic
922337950 1:224632942-224632964 AAAAGGTCCAGGGGGATGCAGGG - Intronic
922601333 1:226857101-226857123 AGAATTTCCTGGGTGATAGAAGG + Intergenic
924013285 1:239691046-239691068 AAAATTTCCTGAGTGATATAAGG - Intronic
924078294 1:240364063-240364085 AAAATTGCCTGGAGTATAAATGG - Intronic
924444935 1:244120399-244120421 AAATTGTCCTGTGGGATATATGG - Intergenic
1063185741 10:3649603-3649625 AAATTATGCTGTGGGATAAAAGG - Intergenic
1063519473 10:6727915-6727937 AAAATGTCATGAGTGATGAAGGG + Intergenic
1065459208 10:25938276-25938298 AACAGGTCCTGGGGCAGAAAAGG + Intronic
1066135514 10:32441735-32441757 GAAAGGCACTGGGGGATAAAGGG + Intergenic
1067521661 10:47012305-47012327 AAAATGGCCTGGGAGAGAATGGG - Intergenic
1069738773 10:70674322-70674344 AAAAGGACCTGGGGGCTACAGGG + Intronic
1070372722 10:75800063-75800085 GAAATGTCAAGGGGGAAAAAAGG - Intronic
1071111998 10:82170249-82170271 AAAATGGCATGGGTGAGAAAAGG + Intronic
1071506002 10:86231983-86232005 AAAATGTCCATGCGGATACACGG - Intronic
1071955040 10:90748793-90748815 AAAAGGGTTTGGGGGATAAAAGG + Intronic
1072450989 10:95539504-95539526 AAAATGCCTTGGGAGTTAAAGGG + Intronic
1072737012 10:97886018-97886040 AAAATGTCTTGATGTATAAAAGG + Intronic
1073852102 10:107633348-107633370 AAATTGTCCTTGGGGAGAGAGGG - Intergenic
1074097960 10:110330501-110330523 AGAATGTACTGTGGGTTAAAGGG + Intergenic
1076324703 10:129612136-129612158 AAAATCTCCTGGTTGATAATTGG + Intronic
1078172683 11:8940725-8940747 AAAATATTCAGGGGGAAAAAAGG + Intergenic
1078470591 11:11582974-11582996 AAAATAGCATGGGGGATAATAGG - Intronic
1081744469 11:45463236-45463258 AGAATGTTCAGGGGGGTAAATGG + Intergenic
1084512984 11:69617630-69617652 AGAATGTCCTGGGGGACGAGGGG + Intergenic
1086003019 11:82002831-82002853 AAGGTGTCTTGGGGGATACATGG + Intergenic
1086065979 11:82745323-82745345 AAACTGCCATGGGGGAAAAAGGG + Intergenic
1088432031 11:109769135-109769157 AAAATCTGCTGTGGGATAAAAGG + Intergenic
1088788421 11:113203078-113203100 AAAATGTCCTGTGGAGGAAAAGG + Intronic
1089004806 11:115082434-115082456 AAAATGACCTGTCAGATAAAGGG - Intergenic
1090056908 11:123431247-123431269 GAAACGTCCTGGGGGAGAACAGG + Intronic
1090991764 11:131823605-131823627 AAAGTGTCTTGGGGAAAAAAAGG + Intronic
1093260408 12:16929625-16929647 GAAATGTCCTGCGAGCTAAACGG - Intergenic
1093397657 12:18703252-18703274 AAAATGAACTGTGTGATAAATGG - Intronic
1093959415 12:25255884-25255906 AAAAGGTGCTGGGTGAGAAAAGG - Intergenic
1095072773 12:37876210-37876232 AAAATGTCCTGTGGCAAACAAGG - Intergenic
1097739074 12:63217816-63217838 AAAAAGTTGTGGGGGACAAAGGG - Intergenic
1097899623 12:64859622-64859644 AAAAAGTAATGGGGGAGAAAGGG + Intronic
1098781328 12:74690518-74690540 TAAATGTCCTGGGGACTAAGTGG + Intergenic
1099072611 12:78064682-78064704 GATATGTCCTTGGGGATATAAGG + Intronic
1099610594 12:84863694-84863716 AAAATGTCATAGGGTATCAATGG - Intronic
1100224105 12:92539018-92539040 AAAGTGTCAAGGGGGAAAAAAGG + Intergenic
1100794468 12:98165560-98165582 AAAATGTGCTGAGGTTTAAATGG - Intergenic
1100812551 12:98353673-98353695 AAATTTTCCTAGGGGAAAAATGG - Intergenic
1102193933 12:111010752-111010774 AAAAAGTCCTGGGGTAGAAGGGG + Intergenic
1104104612 12:125647171-125647193 AAATAGTCTTGGGGGAAAAAGGG + Intronic
1107421010 13:40246434-40246456 AAAATGTGGTGGGGGACATATGG - Intergenic
1107736517 13:43404766-43404788 CTAATGTCCTGGGGAAGAAAGGG + Intronic
1108460612 13:50663613-50663635 AAAATGTTGTGAGGGTTAAATGG - Intronic
1108939076 13:55926733-55926755 AAAATGTCAAGAAGGATAAATGG + Intergenic
1109170145 13:59085086-59085108 AAAATGTCCTGTGTTTTAAATGG + Intergenic
1110068300 13:71138487-71138509 AAAATTACCTGTGAGATAAAAGG + Intergenic
1110371637 13:74747396-74747418 CAAACGTCCTGGGGTATAACTGG + Intergenic
1110561380 13:76913974-76913996 AAAATGTCAGGGAGGAGAAATGG + Intergenic
1111006117 13:82251365-82251387 AAAATGTTATGGGGGAAATAAGG - Intergenic
1111117177 13:83794722-83794744 GAAATGTCCTGGGTGCTGAAGGG - Intergenic
1111279418 13:85999680-85999702 AAAATATAATGGGGAATAAAAGG - Intergenic
1111677864 13:91409571-91409593 AAAATGTCATGGAAAATAAATGG + Intronic
1112172251 13:96986012-96986034 AACATGTCCTGGGGAAGGAAGGG - Exonic
1112548825 13:100400327-100400349 AAAAGGAACTGGGGGAGAAAAGG - Intronic
1115736600 14:36338284-36338306 GAAGTGTGCTGGGGAATAAATGG - Intergenic
1115973668 14:38973637-38973659 AAAATGTCCTCTGGGGGAAAGGG - Intergenic
1117279654 14:54225974-54225996 AAAATGATCTGGGGGAGAGATGG - Intergenic
1117931600 14:60848074-60848096 AAGATGTCCTGCAGGCTAAAAGG - Intronic
1120050246 14:79857594-79857616 ATAGTGTCCTGGGGGATCAAAGG - Intronic
1125081134 15:35674915-35674937 AAAATGCTCTGGGAGAAAAAAGG + Intergenic
1126681740 15:51208775-51208797 AAAATATCCTGGGGGAAAACTGG - Exonic
1126841151 15:52718570-52718592 AAACTGTCCTTGAGAATAAAAGG + Intergenic
1128198420 15:65781754-65781776 AAAATGGCCTGGGGAGTAATGGG + Intronic
1128775331 15:70316073-70316095 ATAATGTCCCTGGGGATACAAGG - Intergenic
1129042693 15:72703584-72703606 AAAATTTTAGGGGGGATAAATGG + Intronic
1129924685 15:79353457-79353479 AAAATTTAATGGGGGAAAAAAGG + Intronic
1130024240 15:80257541-80257563 AAATCGTCCTTGGGGATAACTGG + Intergenic
1130799485 15:87247047-87247069 AGAGTGTAGTGGGGGATAAAAGG + Intergenic
1132348639 15:101123413-101123435 CAAATGTCCTGGGGCAGAAAAGG - Intergenic
1134669067 16:16041239-16041261 AAAATGCTCTGGGTGAAAAATGG - Intronic
1134798013 16:17059220-17059242 AAAATGTCATGTGGGTTCAAAGG - Intergenic
1134800473 16:17079705-17079727 AGAATGTCATGGGGAACAAAAGG - Intergenic
1137737067 16:50732505-50732527 AGAATGTCTTGGGGAACAAACGG - Exonic
1139251699 16:65502620-65502642 ATAGTGTGCTGGGGGAGAAAGGG + Intergenic
1139332278 16:66202551-66202573 AAAGTGACCTGGGGAATTAATGG - Intergenic
1141723279 16:85768776-85768798 AAACTGTCCTGGGGTATCCAGGG + Intergenic
1142701863 17:1667390-1667412 AGAAATTCCTGGGGGATAAGGGG + Intronic
1143344062 17:6236963-6236985 AAAATAACTTGGGGGAAAAAAGG - Intergenic
1144368482 17:14568002-14568024 AAAATCCCCTTGGGGACAAATGG - Intergenic
1144829773 17:18124650-18124672 AAAATGTCCTGGGAGGTGAGAGG - Intronic
1144837441 17:18164074-18164096 AGCATGTCCTGAGGGACAAAGGG - Intronic
1148446105 17:47738455-47738477 AAAATGTGCTTGGGCATCAAGGG - Intronic
1149361039 17:55896265-55896287 ACTATGTCCTGGGTGATAGAGGG - Intergenic
1150361350 17:64537417-64537439 AAAATGTCTTGGGTCATAGATGG - Intronic
1150521666 17:65873587-65873609 TAGGTGTGCTGGGGGATAAATGG - Intronic
1152457637 17:80425385-80425407 AAAATGTCCTGGGGGCAAGGGGG - Intronic
1152923102 17:83075607-83075629 AAAATGGCCTGGGAGGGAAACGG + Intergenic
1153350700 18:4078028-4078050 AAAATGTCATGGGGTTTACAAGG + Intronic
1155272515 18:24154319-24154341 CAGATGTGCTGGTGGATAAAAGG + Intronic
1155328657 18:24691952-24691974 AAAATGACCTGTGGGGTCAAGGG + Intergenic
1156791400 18:40979110-40979132 TAAAAGGCCTGGGGGAGAAAAGG - Intergenic
1157176448 18:45456732-45456754 AAAGTCTCCTGGGGAAGAAAAGG - Intronic
1157994314 18:52536696-52536718 GACATGTCCTAGGGGATAGATGG - Intronic
1158794351 18:60824874-60824896 CAAAGGACCTGAGGGATAAATGG + Intergenic
1163183669 19:15621607-15621629 AAAATGTTCAGGGGGATCACAGG + Intronic
1166476706 19:43132924-43132946 AAGATGTCCTGGGGAAAAACTGG + Intronic
1167834006 19:52051599-52051621 AAAATGTCCTGGGGCATACTCGG + Intronic
925430639 2:3789577-3789599 AAAATAACTTGGGGGATAATTGG - Intronic
926410083 2:12594111-12594133 AACATGTCCTGGGAGAATAAGGG + Intergenic
926951320 2:18246618-18246640 AATATGACTTGGGGGAAAAAAGG - Intronic
927695083 2:25234413-25234435 CAAATACCCTGGGGGAGAAAAGG + Exonic
930865782 2:56120785-56120807 CAGATGTTCTGGGGGAGAAAGGG + Intergenic
931329542 2:61266160-61266182 AAAAATTCCTGGGGAGTAAAAGG + Exonic
932168382 2:69529938-69529960 AGAATGAATTGGGGGATAAAGGG - Intronic
944242679 2:197500597-197500619 AAAGAGCCCTGGGGGAGAAAAGG - Intronic
944325440 2:198398616-198398638 AAATAGTCCTGGTGGAGAAAGGG + Intronic
946540950 2:220684072-220684094 AAAATGCCCTGGGGAATATGTGG + Intergenic
948562336 2:238862781-238862803 AAAATGTCCTGGGAAATAGGTGG + Intronic
948813293 2:240496779-240496801 ACAGTGCCCTGGGGTATAAATGG + Intronic
1169058000 20:2639772-2639794 AAAATATCCTGGGGCTTCAAAGG + Intronic
1171158013 20:22894376-22894398 AAAATGTCCTGGTGCGTAACAGG + Intergenic
1173345694 20:42198019-42198041 AAAATCTCCTGGGGGATGAGAGG - Intronic
1177852950 21:26370391-26370413 AAAATGTTCTGGGGGAGAGACGG + Intergenic
1179166580 21:38939857-38939879 AAGAGGTCCGGGGGCATAAATGG + Intergenic
1181854116 22:25769984-25770006 AGAATCTCCTGGGGGAGAACAGG - Intronic
1184056861 22:42058537-42058559 TAAATGTCCTGGGAGATAGATGG + Exonic
950948892 3:16979245-16979267 AAAATACCCTGGGGGATGAAGGG - Intronic
951061615 3:18214285-18214307 AATATGTCATGGGAGAGAAACGG + Intronic
951531460 3:23702104-23702126 AAAATGTCAAGGGGGATAGCTGG + Intergenic
953771810 3:45783231-45783253 AAAATGTCCAGTGGGAAAAGAGG + Intronic
953963024 3:47281652-47281674 ACAAGGTCCTGAGGGAGAAAGGG - Intronic
954381293 3:50220623-50220645 AAAAGGGCCTAGGGAATAAAAGG - Exonic
955007853 3:54986561-54986583 AAAATGTAAAGGGGGAGAAAAGG - Intronic
955618655 3:60836934-60836956 AAAATATCCTCAGGAATAAAGGG - Intronic
955618786 3:60838557-60838579 AAAATATCCTCAGGAATAAAGGG - Intronic
957484661 3:80842929-80842951 AAAATGTTCTGAGAGAGAAAGGG + Intergenic
957516080 3:81252547-81252569 AAAATATACTGGGAGATAGAGGG - Intergenic
959095886 3:101955198-101955220 AAAACGTCTTGGGGGAGTAAAGG + Intergenic
960365957 3:116772606-116772628 TAAATATTTTGGGGGATAAAAGG - Intronic
961113422 3:124305446-124305468 ACAATGTACTGGGGCATAAGTGG - Intronic
961347168 3:126270861-126270883 AAAATATATTGGGGGAAAAAAGG + Intergenic
961718665 3:128877207-128877229 TAAAAGTCCTGTGAGATAAAGGG + Intergenic
963149307 3:142028033-142028055 AAAATGTACTAGGGAAAAAAAGG + Intronic
963473442 3:145773585-145773607 AATATGTGATGGGGGATAAGTGG - Intergenic
965951721 3:174316847-174316869 AAAGTGTCCTTGGTGATAGAAGG + Intergenic
966500153 3:180630245-180630267 AAAAGTTCCTGAAGGATAAAGGG - Intronic
970425373 4:15940906-15940928 AGAATGTCCACGGGGAGAAATGG + Intergenic
973820754 4:54659372-54659394 AAAATGACCTGGGAGATAGCAGG - Intronic
975117852 4:70698852-70698874 ATAATGTCCTTGGACATAAATGG - Intergenic
975208166 4:71668077-71668099 AAAGTCTCTTGGGTGATAAAAGG + Intergenic
975372678 4:73606878-73606900 CAAATGTCCAGGGGGCTGAAAGG - Intronic
975652670 4:76610000-76610022 AAAATCTCCTGGGCAAGAAAGGG + Intronic
976997295 4:91450809-91450831 AAAATGTCATGGGAAAGAAATGG + Intronic
977180592 4:93868607-93868629 AAGATGTCCTGGGAGAGAAAAGG - Intergenic
979374350 4:119927910-119927932 AAGATGTGCTGCTGGATAAATGG - Intergenic
979483288 4:121242449-121242471 CATTTGTCCTGGGGGATATATGG + Intergenic
979563115 4:122122278-122122300 GAAGTGTCCTGAGAGATAAAGGG + Intergenic
980285524 4:130773933-130773955 AAAAGATCCTGGGGGACAAGTGG + Intergenic
980301555 4:131001476-131001498 AAAATGTCATGGCTGATCAAAGG - Intergenic
981594438 4:146403375-146403397 TAAGTTTCCTGGGGGAAAAATGG - Intronic
982343327 4:154328693-154328715 AAAATGTCCTGTGGCTTAATTGG - Intronic
982927919 4:161363098-161363120 AAAAATTCCAGGGTGATAAAAGG - Intergenic
982952038 4:161711129-161711151 TAAAGGTCCTGGGGGACAAGGGG + Intronic
983795040 4:171851928-171851950 AAAATGCCTTAGGGAATAAAAGG + Intronic
984416183 4:179460856-179460878 AAAATATCATGTGGGAGAAAAGG - Intergenic
987264072 5:16234127-16234149 AAAATGTCCTTGGTTATGAAAGG + Intergenic
988210345 5:28196105-28196127 AAAATATCCTGGAATATAAAAGG - Intergenic
989411341 5:41122821-41122843 AGAATGTCCCGGGGGCTGAAGGG - Intergenic
992517402 5:77508969-77508991 ACAATGTCCTGTGGTATAAATGG + Intronic
993739837 5:91524756-91524778 AAAATGTGCTAGGGTATAACTGG - Intergenic
994769044 5:103957825-103957847 AAAATAACCAGAGGGATAAATGG + Intergenic
995455064 5:112342510-112342532 AAATTGGCCTGGCTGATAAAAGG - Intronic
995484579 5:112627350-112627372 CAAATGTCCCTGGGGGTAAAGGG + Intergenic
995647627 5:114330356-114330378 AAAATGGTCTGGGGCATAAATGG - Intergenic
995772342 5:115685033-115685055 AAAAAGTCCTGGAAGATAGAAGG - Intergenic
1001203616 5:169741777-169741799 AAAAGATCCTGGGAGATAAGTGG - Intronic
1001402530 5:171454171-171454193 GAATTGTCCAGGGAGATAAAGGG + Intronic
1001793534 5:174482615-174482637 AAAATGTGCTGGGGAGTAAACGG - Intergenic
1002872669 6:1181141-1181163 AAAAGGGGCTGGGGAATAAAGGG + Intergenic
1004097696 6:12575005-12575027 AAAATATTCTAGGGGATAAAGGG - Intergenic
1004321347 6:14633929-14633951 AAAATATCCTGGAGGACAATGGG - Intergenic
1005112735 6:22301688-22301710 AAAATGTATTGGAGGATAAAGGG - Intergenic
1005501110 6:26430006-26430028 ACACTGTCCTGGAGGATAAAGGG - Intergenic
1005505663 6:26467154-26467176 ACACTGTCCTGGAGGATAAAGGG - Intronic
1006357206 6:33566966-33566988 AAAATGTCCTGTGGGTTGAGAGG + Intergenic
1008761201 6:54852855-54852877 AAACTGTCCTGGGCTATATATGG - Intronic
1008775322 6:55031516-55031538 GAAATATCCTGTGGGACAAAAGG - Intergenic
1011672909 6:89701164-89701186 AAAATATTCAGGGGGAAAAATGG + Intronic
1013624434 6:111922656-111922678 GAAATGCATTGGGGGATAAATGG + Intergenic
1013956185 6:115843786-115843808 AAAATGGGATGGGGCATAAATGG - Intergenic
1014672285 6:124320500-124320522 AATATGTATTGGGGGATAAAGGG - Intronic
1016049445 6:139515191-139515213 AAAATGACCTGGGAGAGAAGAGG + Intergenic
1017297342 6:152813345-152813367 AAAATGTCCTGGACATTAAAGGG - Intergenic
1017663335 6:156695189-156695211 AAAATGTTCTGGAGGATAGTGGG + Intergenic
1018523877 6:164685559-164685581 CCCATGTCCTGGAGGATAAATGG - Intergenic
1018617381 6:165700621-165700643 ACAATGTATTGGGTGATAAATGG - Intronic
1019935811 7:4256855-4256877 AAAATGTCCTGGGGGATAAAAGG - Intronic
1020870592 7:13624417-13624439 AAAAGGTACTGGGGAACAAAAGG + Intergenic
1020897851 7:13964418-13964440 GAAAAGTTCTGGGGGATAAATGG + Intronic
1020915851 7:14191667-14191689 AAACTCTTCTGGGGGACAAAGGG + Intronic
1021469116 7:20981175-20981197 AAAGTGGGCAGGGGGATAAAAGG + Intergenic
1021795884 7:24254025-24254047 AGAATCTTCTGGGGCATAAAGGG - Intergenic
1022590038 7:31652787-31652809 AAATTGTCCTGTTGGAGAAAAGG + Intronic
1024122450 7:46258330-46258352 AAAATGTCCTTTGGAATAAGTGG + Intergenic
1027470079 7:78562720-78562742 ATAATGTCCTGGGCAATAATTGG + Intronic
1029940804 7:104478811-104478833 AAAATGTCTTTGGGGATAGCAGG + Intronic
1030389122 7:108903682-108903704 AAAATGTTCTGGGGATTATAGGG + Intergenic
1030397315 7:109003177-109003199 AAATTTTACTGGGGTATAAAGGG - Intergenic
1032210399 7:129909216-129909238 AAAATGTCAGGTGGGAAAAATGG + Intronic
1032729825 7:134629567-134629589 AGAATTTCCTGAGTGATAAAGGG + Intergenic
1033181273 7:139181272-139181294 AAAATGTCCTGCAGACTAAATGG + Intronic
1033426621 7:141250623-141250645 AAGAAGTCCAGGGGGATTAAAGG - Intronic
1033484933 7:141779297-141779319 AGAATGTCCTGGAGAGTAAAGGG - Exonic
1035097888 7:156370602-156370624 AAAATGTCCTGAAGGATAGAAGG - Intergenic
1036273548 8:7330604-7330626 AAAGTGTCCTGGGGGAAGAAAGG - Intergenic
1036274113 8:7335346-7335368 AAAGTGTCCTGGGGGAAGAAAGG - Intergenic
1036274685 8:7340066-7340088 AAAGTGTCCTGGGTGAAGAAAGG - Intergenic
1036346668 8:7970280-7970302 AAAGTGTCCTGGGTGAAGAAAGG + Intergenic
1036347236 8:7975002-7975024 AAAGTGTCCTGGGGGAAGAAAGG + Intergenic
1036347799 8:7979748-7979770 AAAGTGTCCTGGGGGAAGAAAGG + Intergenic
1036617397 8:10399229-10399251 ACAATGTCTAGGGGGAGAAATGG + Intronic
1036841991 8:12131034-12131056 AAAGTGTCCTGGGTGAAGAAAGG + Intergenic
1036842552 8:12135788-12135810 AAAGTGTCCTGGGGGAAGAAAGG + Intergenic
1036843119 8:12140517-12140539 AAAGTGTCCTGGGGGAAGAAAGG + Intergenic
1036863822 8:12377284-12377306 AAAGTGTCCTGGGTGAAGAAAGG + Intergenic
1036864446 8:12382328-12382350 AAAGTGTCCTGGGGGAAGAAAGG + Intergenic
1037105948 8:15108368-15108390 TGAATGTCCTGAGGGCTAAAGGG + Intronic
1037716275 8:21403593-21403615 ATAATGTTTTGGGGGTTAAAAGG + Intergenic
1038252286 8:25916471-25916493 AAAATGTGGTGGGGGAGAAAGGG - Intronic
1038606940 8:29016424-29016446 ATAGTGTATTGGGGGATAAAGGG + Intronic
1038938450 8:32278054-32278076 AAAATGTCCTGAGAGAAAAGTGG - Intronic
1038943278 8:32329494-32329516 ATAATGTGATGGGGGATAAAAGG + Intronic
1039623709 8:39025757-39025779 AAAATGTTCTTGGGGAAAAAAGG - Intronic
1040600205 8:48876139-48876161 TAAATGTCATGGGGCAAAAATGG - Intergenic
1041165028 8:55083244-55083266 AAAAATTCCTGGGAGAAAAAAGG - Intergenic
1042154630 8:65830153-65830175 AAAATATCCAGGTGGACAAAAGG + Intronic
1042455142 8:68992730-68992752 AAAGTGTCCTGGGCTTTAAAGGG - Intergenic
1044351463 8:91171269-91171291 AAAATTTCATGGGGGGTAAGAGG - Intronic
1044725526 8:95191510-95191532 CAGATGTCCTGGGGGATGAGGGG + Intergenic
1045243527 8:100422930-100422952 ACAGTGTCCTAGGGGATAACTGG + Intergenic
1046213635 8:111113902-111113924 AAGAAGTCTTGGTGGATAAATGG + Intergenic
1046261969 8:111780435-111780457 AAAATGTCCTGGAGGGAGAATGG + Intergenic
1047778221 8:128091032-128091054 AGACTTTCCTGGGGGATTAAAGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1049380569 8:142312869-142312891 CAAATGTCCTGGGGGTGAGAAGG + Intronic
1050525140 9:6539941-6539963 AAACTGATCTGGGGGATAAATGG - Intronic
1051065227 9:13094237-13094259 AAAGTGTGGTGGGGGAAAAATGG + Intergenic
1051095672 9:13462970-13462992 CAAATATCATGGGGGAGAAATGG - Intergenic
1052402340 9:28016364-28016386 AAAATATCCTAGAAGATAAAAGG - Intronic
1058965871 9:110037942-110037964 AGAATGGCCTGAGGGATAGAAGG + Intronic
1185886816 X:3790389-3790411 AAAATGTCACGGCGAATAAAGGG + Intergenic
1188066316 X:25664515-25664537 AAAATGTGCTGAAGGAAAAAAGG + Intergenic
1188963845 X:36526696-36526718 GAAATGGCCTGGGTGACAAAAGG + Intergenic
1189080628 X:37968382-37968404 AAAATGGTCTGGGGGTAAAAAGG - Intronic
1190399280 X:50015349-50015371 AGGATGTCCTGGAAGATAAAGGG - Intronic
1190946624 X:55101064-55101086 AAACTGTCTTGGGGGAAACAAGG + Intronic
1195095779 X:101499798-101499820 ATAATGTCCTGGGGGGAAATAGG + Intronic
1195599005 X:106725164-106725186 AAAATTACCTAGGGGAAAAATGG - Intronic
1196239729 X:113328699-113328721 AGAATCTCCTGGGGGCTACAAGG + Intergenic
1196557741 X:117110067-117110089 AAAGTGTCCTTGGGGATCACTGG + Intergenic
1196633453 X:117971540-117971562 AAAATATCCTGGAGCATAAACGG + Intronic
1196883264 X:120219853-120219875 TAAATGTCCTCCAGGATAAAGGG + Intergenic
1197685716 X:129437420-129437442 AAAATGTCCTGAGGAAGAGAGGG + Intergenic
1199681437 X:150227347-150227369 AAAATGAACTGGGGGGAAAAAGG + Intergenic
1202341263 Y:23871318-23871340 AAAATCTCCTTGGGGAAAGATGG + Intergenic
1202529503 Y:25798768-25798790 AAAATCTCCTTGGGGAAAGATGG - Intergenic