ID: 1019940563

View in Genome Browser
Species Human (GRCh38)
Location 7:4285974-4285996
Sequence AAAACTGAGGTGAGCACAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019940560_1019940563 22 Left 1019940560 7:4285929-4285951 CCAATGGTTACATTTCACATAAC 0: 2
1: 0
2: 10
3: 60
4: 350
Right 1019940563 7:4285974-4285996 AAAACTGAGGTGAGCACAATTGG No data
1019940559_1019940563 23 Left 1019940559 7:4285928-4285950 CCCAATGGTTACATTTCACATAA 0: 2
1: 1
2: 20
3: 111
4: 569
Right 1019940563 7:4285974-4285996 AAAACTGAGGTGAGCACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019940563 Original CRISPR AAAACTGAGGTGAGCACAAT TGG Intergenic
No off target data available for this crispr