ID: 1019943328

View in Genome Browser
Species Human (GRCh38)
Location 7:4308196-4308218
Sequence CCTTCCTCCCGTTGGCTCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019943318_1019943328 16 Left 1019943318 7:4308157-4308179 CCCCAAGTTGACCAACTCCATCT No data
Right 1019943328 7:4308196-4308218 CCTTCCTCCCGTTGGCTCTGCGG No data
1019943313_1019943328 26 Left 1019943313 7:4308147-4308169 CCCCCACCAGCCCCAAGTTGACC No data
Right 1019943328 7:4308196-4308218 CCTTCCTCCCGTTGGCTCTGCGG No data
1019943316_1019943328 23 Left 1019943316 7:4308150-4308172 CCACCAGCCCCAAGTTGACCAAC No data
Right 1019943328 7:4308196-4308218 CCTTCCTCCCGTTGGCTCTGCGG No data
1019943317_1019943328 20 Left 1019943317 7:4308153-4308175 CCAGCCCCAAGTTGACCAACTCC No data
Right 1019943328 7:4308196-4308218 CCTTCCTCCCGTTGGCTCTGCGG No data
1019943314_1019943328 25 Left 1019943314 7:4308148-4308170 CCCCACCAGCCCCAAGTTGACCA No data
Right 1019943328 7:4308196-4308218 CCTTCCTCCCGTTGGCTCTGCGG No data
1019943315_1019943328 24 Left 1019943315 7:4308149-4308171 CCCACCAGCCCCAAGTTGACCAA No data
Right 1019943328 7:4308196-4308218 CCTTCCTCCCGTTGGCTCTGCGG No data
1019943320_1019943328 14 Left 1019943320 7:4308159-4308181 CCAAGTTGACCAACTCCATCTAG No data
Right 1019943328 7:4308196-4308218 CCTTCCTCCCGTTGGCTCTGCGG No data
1019943319_1019943328 15 Left 1019943319 7:4308158-4308180 CCCAAGTTGACCAACTCCATCTA No data
Right 1019943328 7:4308196-4308218 CCTTCCTCCCGTTGGCTCTGCGG No data
1019943324_1019943328 -1 Left 1019943324 7:4308174-4308196 CCATCTAGGTTCCTGGACTTGTC No data
Right 1019943328 7:4308196-4308218 CCTTCCTCCCGTTGGCTCTGCGG No data
1019943323_1019943328 5 Left 1019943323 7:4308168-4308190 CCAACTCCATCTAGGTTCCTGGA No data
Right 1019943328 7:4308196-4308218 CCTTCCTCCCGTTGGCTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019943328 Original CRISPR CCTTCCTCCCGTTGGCTCTG CGG Intergenic
No off target data available for this crispr