ID: 1019946974

View in Genome Browser
Species Human (GRCh38)
Location 7:4337752-4337774
Sequence CTCTTTCAATTTAAGATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019946972_1019946974 -2 Left 1019946972 7:4337731-4337753 CCACTAAGCCACGTGGATTTACT No data
Right 1019946974 7:4337752-4337774 CTCTTTCAATTTAAGATGTCAGG No data
1019946964_1019946974 26 Left 1019946964 7:4337703-4337725 CCCATAATAGTCCCGTTTCCTCA No data
Right 1019946974 7:4337752-4337774 CTCTTTCAATTTAAGATGTCAGG No data
1019946965_1019946974 25 Left 1019946965 7:4337704-4337726 CCATAATAGTCCCGTTTCCTCAA No data
Right 1019946974 7:4337752-4337774 CTCTTTCAATTTAAGATGTCAGG No data
1019946970_1019946974 0 Left 1019946970 7:4337729-4337751 CCCCACTAAGCCACGTGGATTTA No data
Right 1019946974 7:4337752-4337774 CTCTTTCAATTTAAGATGTCAGG No data
1019946973_1019946974 -10 Left 1019946973 7:4337739-4337761 CCACGTGGATTTACTCTTTCAAT No data
Right 1019946974 7:4337752-4337774 CTCTTTCAATTTAAGATGTCAGG No data
1019946968_1019946974 8 Left 1019946968 7:4337721-4337743 CCTCAAATCCCCACTAAGCCACG No data
Right 1019946974 7:4337752-4337774 CTCTTTCAATTTAAGATGTCAGG No data
1019946971_1019946974 -1 Left 1019946971 7:4337730-4337752 CCCACTAAGCCACGTGGATTTAC No data
Right 1019946974 7:4337752-4337774 CTCTTTCAATTTAAGATGTCAGG No data
1019946966_1019946974 15 Left 1019946966 7:4337714-4337736 CCCGTTTCCTCAAATCCCCACTA No data
Right 1019946974 7:4337752-4337774 CTCTTTCAATTTAAGATGTCAGG No data
1019946967_1019946974 14 Left 1019946967 7:4337715-4337737 CCGTTTCCTCAAATCCCCACTAA No data
Right 1019946974 7:4337752-4337774 CTCTTTCAATTTAAGATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019946974 Original CRISPR CTCTTTCAATTTAAGATGTC AGG Intergenic
No off target data available for this crispr