ID: 1019951159

View in Genome Browser
Species Human (GRCh38)
Location 7:4373868-4373890
Sequence CTGGTGTTTGTAAGGACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019951156_1019951159 1 Left 1019951156 7:4373844-4373866 CCAAAGCATAGTGTTGAGGGCTG No data
Right 1019951159 7:4373868-4373890 CTGGTGTTTGTAAGGACAACAGG No data
1019951155_1019951159 2 Left 1019951155 7:4373843-4373865 CCCAAAGCATAGTGTTGAGGGCT No data
Right 1019951159 7:4373868-4373890 CTGGTGTTTGTAAGGACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019951159 Original CRISPR CTGGTGTTTGTAAGGACAAC AGG Intergenic
No off target data available for this crispr