ID: 1019951234

View in Genome Browser
Species Human (GRCh38)
Location 7:4374551-4374573
Sequence GAGGATGACCTTGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019951234_1019951240 -3 Left 1019951234 7:4374551-4374573 CCTTCCTCCTCAAGGTCATCCTC No data
Right 1019951240 7:4374571-4374593 CTCTTCATCACCGGGTAGCCTGG No data
1019951234_1019951245 28 Left 1019951234 7:4374551-4374573 CCTTCCTCCTCAAGGTCATCCTC No data
Right 1019951245 7:4374602-4374624 ATGTTTTCCTAACTATCTAATGG No data
1019951234_1019951241 -2 Left 1019951234 7:4374551-4374573 CCTTCCTCCTCAAGGTCATCCTC No data
Right 1019951241 7:4374572-4374594 TCTTCATCACCGGGTAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019951234 Original CRISPR GAGGATGACCTTGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr