ID: 1019951684

View in Genome Browser
Species Human (GRCh38)
Location 7:4378310-4378332
Sequence CTGTGGGTCATGAATTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019951679_1019951684 21 Left 1019951679 7:4378266-4378288 CCAAAACTTAAAGACTTTAAAAC No data
Right 1019951684 7:4378310-4378332 CTGTGGGTCATGAATTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019951684 Original CRISPR CTGTGGGTCATGAATTCAGG AGG Intergenic
No off target data available for this crispr