ID: 1019953301

View in Genome Browser
Species Human (GRCh38)
Location 7:4390855-4390877
Sequence CTGTGATTCTTCAGGTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019953297_1019953301 -9 Left 1019953297 7:4390841-4390863 CCAAATTTATGAACCTGTGATTC No data
Right 1019953301 7:4390855-4390877 CTGTGATTCTTCAGGTGACAGGG No data
1019953295_1019953301 -4 Left 1019953295 7:4390836-4390858 CCCTTCCAAATTTATGAACCTGT No data
Right 1019953301 7:4390855-4390877 CTGTGATTCTTCAGGTGACAGGG No data
1019953296_1019953301 -5 Left 1019953296 7:4390837-4390859 CCTTCCAAATTTATGAACCTGTG No data
Right 1019953301 7:4390855-4390877 CTGTGATTCTTCAGGTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019953301 Original CRISPR CTGTGATTCTTCAGGTGACA GGG Intergenic
No off target data available for this crispr