ID: 1019954330

View in Genome Browser
Species Human (GRCh38)
Location 7:4401406-4401428
Sequence ATTTGCAGGTAATTAAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019954330_1019954339 6 Left 1019954330 7:4401406-4401428 CCCACTTTTAATTACCTGCAAAT No data
Right 1019954339 7:4401435-4401457 GTAGGTCAATGCAAGCTGAGGGG No data
1019954330_1019954340 12 Left 1019954330 7:4401406-4401428 CCCACTTTTAATTACCTGCAAAT No data
Right 1019954340 7:4401441-4401463 CAATGCAAGCTGAGGGGTGCTGG No data
1019954330_1019954337 4 Left 1019954330 7:4401406-4401428 CCCACTTTTAATTACCTGCAAAT No data
Right 1019954337 7:4401433-4401455 GGGTAGGTCAATGCAAGCTGAGG No data
1019954330_1019954338 5 Left 1019954330 7:4401406-4401428 CCCACTTTTAATTACCTGCAAAT No data
Right 1019954338 7:4401434-4401456 GGTAGGTCAATGCAAGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019954330 Original CRISPR ATTTGCAGGTAATTAAAAGT GGG (reversed) Intergenic
No off target data available for this crispr