ID: 1019954331

View in Genome Browser
Species Human (GRCh38)
Location 7:4401407-4401429
Sequence AATTTGCAGGTAATTAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019954331_1019954338 4 Left 1019954331 7:4401407-4401429 CCACTTTTAATTACCTGCAAATT No data
Right 1019954338 7:4401434-4401456 GGTAGGTCAATGCAAGCTGAGGG No data
1019954331_1019954339 5 Left 1019954331 7:4401407-4401429 CCACTTTTAATTACCTGCAAATT No data
Right 1019954339 7:4401435-4401457 GTAGGTCAATGCAAGCTGAGGGG No data
1019954331_1019954340 11 Left 1019954331 7:4401407-4401429 CCACTTTTAATTACCTGCAAATT No data
Right 1019954340 7:4401441-4401463 CAATGCAAGCTGAGGGGTGCTGG No data
1019954331_1019954337 3 Left 1019954331 7:4401407-4401429 CCACTTTTAATTACCTGCAAATT No data
Right 1019954337 7:4401433-4401455 GGGTAGGTCAATGCAAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019954331 Original CRISPR AATTTGCAGGTAATTAAAAG TGG (reversed) Intergenic
No off target data available for this crispr