ID: 1019954336

View in Genome Browser
Species Human (GRCh38)
Location 7:4401420-4401442
Sequence TGACCTACCCCTTAATTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019954336_1019954342 30 Left 1019954336 7:4401420-4401442 CCTGCAAATTAAGGGGTAGGTCA No data
Right 1019954342 7:4401473-4401495 CTTATGCCAATGAGCAATGAGGG 0: 7
1: 23
2: 46
3: 46
4: 165
1019954336_1019954338 -9 Left 1019954336 7:4401420-4401442 CCTGCAAATTAAGGGGTAGGTCA No data
Right 1019954338 7:4401434-4401456 GGTAGGTCAATGCAAGCTGAGGG No data
1019954336_1019954341 29 Left 1019954336 7:4401420-4401442 CCTGCAAATTAAGGGGTAGGTCA No data
Right 1019954341 7:4401472-4401494 TCTTATGCCAATGAGCAATGAGG 0: 5
1: 26
2: 46
3: 49
4: 176
1019954336_1019954340 -2 Left 1019954336 7:4401420-4401442 CCTGCAAATTAAGGGGTAGGTCA No data
Right 1019954340 7:4401441-4401463 CAATGCAAGCTGAGGGGTGCTGG No data
1019954336_1019954337 -10 Left 1019954336 7:4401420-4401442 CCTGCAAATTAAGGGGTAGGTCA No data
Right 1019954337 7:4401433-4401455 GGGTAGGTCAATGCAAGCTGAGG No data
1019954336_1019954339 -8 Left 1019954336 7:4401420-4401442 CCTGCAAATTAAGGGGTAGGTCA No data
Right 1019954339 7:4401435-4401457 GTAGGTCAATGCAAGCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019954336 Original CRISPR TGACCTACCCCTTAATTTGC AGG (reversed) Intergenic
No off target data available for this crispr