ID: 1019954337

View in Genome Browser
Species Human (GRCh38)
Location 7:4401433-4401455
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019954331_1019954337 3 Left 1019954331 7:4401407-4401429 CCACTTTTAATTACCTGCAAATT No data
Right 1019954337 7:4401433-4401455 GGGTAGGTCAATGCAAGCTGAGG No data
1019954336_1019954337 -10 Left 1019954336 7:4401420-4401442 CCTGCAAATTAAGGGGTAGGTCA No data
Right 1019954337 7:4401433-4401455 GGGTAGGTCAATGCAAGCTGAGG No data
1019954330_1019954337 4 Left 1019954330 7:4401406-4401428 CCCACTTTTAATTACCTGCAAAT No data
Right 1019954337 7:4401433-4401455 GGGTAGGTCAATGCAAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019954337 Original CRISPR GGGTAGGTCAATGCAAGCTG AGG Intergenic