ID: 1019954341

View in Genome Browser
Species Human (GRCh38)
Location 7:4401472-4401494
Sequence TCTTATGCCAATGAGCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 5, 1: 26, 2: 46, 3: 49, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019954336_1019954341 29 Left 1019954336 7:4401420-4401442 CCTGCAAATTAAGGGGTAGGTCA No data
Right 1019954341 7:4401472-4401494 TCTTATGCCAATGAGCAATGAGG 0: 5
1: 26
2: 46
3: 49
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019954341 Original CRISPR TCTTATGCCAATGAGCAATG AGG Intergenic
901412986 1:9098005-9098027 TGTTATGCCTAGGAGCAATTTGG - Intergenic
902153420 1:14463252-14463274 TCTTATGCTAATGAGCAATGAGG + Intergenic
902260099 1:15218692-15218714 TCCCATGCTGATGAGCAATGAGG - Intronic
904783404 1:32967298-32967320 TGTTATGCCATTGAGAAATTTGG - Intergenic
905764927 1:40592385-40592407 TCTTATGCTAATGAGTAACGAGG - Intergenic
906234398 1:44195756-44195778 TCTTATGCTAATGAGAAATGAGG - Intergenic
906499858 1:46333711-46333733 TCTTATGCTAATGACCAGTGAGG - Intergenic
908560098 1:65297789-65297811 TGTTACCCCAAGGAGCAATGGGG - Intronic
909051918 1:70776711-70776733 TCTTATGCTAACGAGCAATGAGG - Intergenic
909973042 1:82013730-82013752 TCTTATGCCAATGGTGAATAGGG + Intergenic
910034544 1:82775626-82775648 TCTTATGCTAATGAGCAGCGCGG - Intergenic
913403158 1:118458202-118458224 TCTTATGCCCTTGAGAAAAGAGG - Intergenic
913613855 1:120536045-120536067 TTTTATTCCAGTTAGCAATGGGG + Intergenic
913659698 1:120995214-120995236 CTTTATGCTAATGAGCAGTGAGG + Intergenic
914373085 1:147047875-147047897 TTTTATTCCAGTTAGCAATGGGG + Intergenic
914576412 1:148974849-148974871 TTTTATTCCAGTTAGCAATGGGG - Intronic
914649679 1:149686993-149687015 CTTTATGCTAATGAGCAGTGAGG + Intergenic
916284076 1:163085154-163085176 TCTTTTGCTTATGAGCCATGAGG - Intergenic
917363514 1:174203270-174203292 TCATATACAAATGAGCAATGGGG - Intronic
918452520 1:184673293-184673315 TTTTATCCCCAGGAGCAATGTGG - Intergenic
918682410 1:187371912-187371934 TCTTATACTAATGAGCAATGAGG - Intergenic
918682520 1:187372881-187372903 TCTTATGCTAATGAGGAATGAGG + Intergenic
919374511 1:196777514-196777536 TGTTATGCCAAAGTGTAATGGGG - Intronic
919621959 1:199873164-199873186 TTATATGCCACTGAGAAATGGGG - Intergenic
920547404 1:206829798-206829820 TCTTATGTCAATGGGCTCTGTGG - Intronic
920566254 1:206975901-206975923 AGTTATTACAATGAGCAATGGGG - Intergenic
921824747 1:219660171-219660193 TTTTATTCTAATGAGCAATCTGG + Intergenic
922221686 1:223613253-223613275 TCTGCTGCCAATGACCCATGGGG - Intronic
922968592 1:229715201-229715223 TCTCATGCTAATGAGCAATGAGG - Intergenic
923202440 1:231725380-231725402 TCTTATGCTAATGAGCAATAAGG - Intronic
923804725 1:237245338-237245360 TCTCATGCCATTGCTCAATGTGG - Intronic
924273029 1:242354162-242354184 TCTTATGCCTATGAGCAAGGAGG - Intronic
1063274422 10:4549271-4549293 CCTTATGCTAATGAGCAGTGGGG - Intergenic
1063533873 10:6863588-6863610 CTTTATGCTAATGAACAATGAGG + Intergenic
1063611621 10:7567628-7567650 TATGATGCCACTGAGCAGTGTGG + Intronic
1063965950 10:11345950-11345972 TCTTATGTGAATGAGCAATGAGG + Intergenic
1063966847 10:11352660-11352682 CCTTATGCTAATGAGCAGTGAGG + Intergenic
1063966927 10:11353395-11353417 TCTTATGCTAATGAGCAATGAGG - Intergenic
1065430923 10:25654577-25654599 TCTTATCCCTAGGAGCAATTGGG + Intergenic
1066711683 10:38242497-38242519 TCTTATGCCTATGAGCAAGGAGG + Intergenic
1069097394 10:64275996-64276018 TCTGGTGACAATGAGCTATGCGG + Intergenic
1069265766 10:66455511-66455533 TCTTATGCTGATGAGCAGTGGGG - Intronic
1071166996 10:82818244-82818266 TCTTATGCTGATGGGCAGTGAGG + Intronic
1071777407 10:88804626-88804648 TCTTATGCTAATGAGCAGCCGGG - Intronic
1072257705 10:93636211-93636233 TCTTTGGCCAATGAGCATTTTGG - Intronic
1072320680 10:94246640-94246662 TATTATGCCAGTGAGGAAAGAGG - Intronic
1074567132 10:114590270-114590292 TCTTATGTCACTCAACAATGGGG - Intronic
1075363612 10:121862807-121862829 TCTTATGCCAATGAACAGCAAGG - Intronic
1076200580 10:128554578-128554600 TCTTATGCTAATGAGCAATGAGG + Intergenic
1077883910 11:6371785-6371807 TCTTATGAAAATGTGCAGTGTGG + Intergenic
1077983132 11:7321907-7321929 TATGATGTAAATGAGCAATGAGG + Intronic
1078982593 11:16553514-16553536 TCTTATGCTAATGAACAATGAGG + Intronic
1079242432 11:18729960-18729982 TCTGGTGCCACTGGGCAATGTGG - Intronic
1079755842 11:24260370-24260392 TTGTATGCCAATGTGCAATAGGG - Intergenic
1081334786 11:41851514-41851536 TCTTATTCAAATGAGCAAATTGG - Intergenic
1083543509 11:63531592-63531614 TCTTATGCTAATGAGCAGTGAGG + Intergenic
1083700320 11:64473118-64473140 TCTTATGCTAATGAGCCCTGAGG - Intergenic
1083909909 11:65700626-65700648 TCTTATGCTAAGGAACAATGAGG + Intergenic
1083915740 11:65742542-65742564 TCTTATGCTAATGAATAATGAGG + Intergenic
1085405609 11:76260049-76260071 TCTGAGGGCAATGAGCAATGAGG + Intergenic
1086554439 11:88092072-88092094 TCGTATGGCAGTGATCAATGAGG + Intergenic
1086908093 11:92440302-92440324 TATTAAGCCAATGACCACTGTGG + Intronic
1087871703 11:103302563-103302585 TCTTATGCCCATGTGTTATGGGG - Intronic
1088077240 11:105865336-105865358 TCTAAATCCAATGAGCAATTTGG + Intronic
1088380219 11:109184515-109184537 TATTATGCTAATGAGCAATGAGG + Intergenic
1094475980 12:30840892-30840914 TCTAATGCAAGTGAGCAATGAGG + Intergenic
1095620582 12:44248835-44248857 GCTAATGCCAATGAGAAATTTGG - Intronic
1096351342 12:50903600-50903622 TCTTCAGCCAATGAACACTGTGG - Intergenic
1096904627 12:54923867-54923889 TCTTTTGCTTATGAGCAATCAGG + Intergenic
1099153177 12:79140875-79140897 ACTTATGCCAATCAACAATGTGG - Intronic
1099562470 12:84195241-84195263 TCTTATGCTAATGAGTAACGAGG - Intergenic
1099839157 12:87944123-87944145 TCTTATGCTAATGGACAATAAGG + Intergenic
1100322309 12:93507546-93507568 TTTTAAGCCAATGAGCTTTGGGG - Exonic
1101178114 12:102178236-102178258 TCTTATGCCAAAGAATGATGAGG - Intronic
1101530475 12:105568877-105568899 TCTTATGTTAATGAGCAATGAGG + Intergenic
1103807634 12:123585385-123585407 TCTTCTGCCAAGGAGAGATGGGG + Intronic
1103876526 12:124131718-124131740 TCTTATTCCTAGGAGCAATCTGG - Intronic
1104434265 12:128743261-128743283 TCTTATGCCAATGAGCAATGAGG - Intergenic
1105672003 13:22629531-22629553 CTTTATGCTAATGAGCAGTGAGG - Intergenic
1106586395 13:31060151-31060173 TATTATGCCAATGGACAAGGTGG - Intergenic
1108048436 13:46405609-46405631 TCTTATGCTAATGAGCAGCTAGG - Intronic
1108155362 13:47578782-47578804 TGTTATGCCCAGGAGCAATTTGG - Intergenic
1108376798 13:49821602-49821624 TCTTATGCTAATGAGCAATGAGG - Intergenic
1108862969 13:54884845-54884867 TCCTATGCTAATGAGCAATAAGG - Intergenic
1109113144 13:58348924-58348946 AATGATTCCAATGAGCAATGAGG - Intergenic
1110497037 13:76180203-76180225 TCCCATGCTAATGATCAATGGGG - Intergenic
1111179613 13:84645895-84645917 TCTTCTGCTAATGAGCAATGAGG + Intergenic
1111534878 13:89590215-89590237 TCATATTCCAAAGAGGAATGAGG - Intergenic
1112582506 13:100688580-100688602 TCTTATGCTAATGAGCAATGAGG + Intergenic
1112583594 13:100697307-100697329 TCTTATACTAATGAGCAATGAGG + Intergenic
1112751508 13:102588475-102588497 TTTTATGTCAATGAGCAATGAGG + Intergenic
1112966111 13:105196202-105196224 TCTTATGCTAATGAGCAATGAGG + Intergenic
1114850660 14:26379019-26379041 TCTCATGCTAATGAGCAATGAGG + Intergenic
1115139317 14:30151009-30151031 TCTTACGCTAATGAGCAATGAGG - Intronic
1116239236 14:42320195-42320217 TCTTATGTGAATGAGCAATGAGG + Intergenic
1116259419 14:42603567-42603589 TCTTATGCTAATGAGCAATGAGG + Intergenic
1120123998 14:80719081-80719103 TCTTATGCCAATGAGCAATGAGG - Intronic
1120209000 14:81615855-81615877 TGTTATCCCAAGGAGCAATTTGG + Intergenic
1120623537 14:86795465-86795487 TGATAGGCCAGTGAGCAATGAGG - Intergenic
1121514017 14:94536990-94537012 TCTTATGCTGATGAGCAGTGAGG + Intergenic
1123821986 15:24039898-24039920 TCTTAAGGCAGTGAGCAATGAGG - Intergenic
1123829639 15:24121232-24121254 TCTCATGCCAGTGAGCAATGAGG + Intergenic
1123859638 15:24450895-24450917 TCTCATGCCAGTGAGCAATGAGG + Intergenic
1124025133 15:25958898-25958920 TCTTATCCCTAGGAGCAATTTGG + Intergenic
1124440510 15:29682321-29682343 TCTTGTGCTAATGGACAATGAGG - Intergenic
1128371125 15:67040099-67040121 TCTAATACCCATGAGCACTGTGG - Intergenic
1132023069 15:98381644-98381666 TATTATGCCAGTGAGAAATGTGG - Intergenic
1136358454 16:29761933-29761955 TCTTACCCTAATGAGCAATGAGG - Intergenic
1138777457 16:59741060-59741082 TCTTATGCCTATGAGGAATGAGG + Intronic
1138859270 16:60735783-60735805 TCTCATGCTGATGAGCAATGAGG - Intergenic
1139102919 16:63789756-63789778 TCTTATGCTAATTAGCAGTGAGG + Intergenic
1140090919 16:71838118-71838140 TATTATGACCATGAACAATGAGG - Intergenic
1140300564 16:73753328-73753350 TCTCATGCAAGTGAGCAATGAGG - Intergenic
1140437107 16:74956361-74956383 TCTTTTCCAAATGAGCAATGAGG + Intronic
1140614174 16:76640092-76640114 TCCCAGGCCAGTGAGCAATGAGG + Intergenic
1140700751 16:77579457-77579479 TCCTTTGCAAATGAGCAAAGAGG - Intergenic
1141175631 16:81717097-81717119 TGTTATGCCCAGGAGCAATCTGG + Intergenic
1142158087 16:88542016-88542038 TGTTATGCCAGAGAACAATGAGG + Intergenic
1143466720 17:7141901-7141923 TGTTATTCCCAGGAGCAATGTGG - Intergenic
1144189191 17:12828371-12828393 TCTTATCCCAGTTTGCAATGAGG + Intronic
1144281116 17:13727433-13727455 TCTAATATTAATGAGCAATGAGG + Intergenic
1144303078 17:13941457-13941479 TCTTATGCCAATGAGTAATGAGG + Intergenic
1144424838 17:15132139-15132161 TCTTACACCAATGAGCAATGAGG - Intergenic
1148903749 17:50898419-50898441 TGTTATACTTATGAGCAATGGGG + Intergenic
1149219456 17:54399279-54399301 TCTGATGCAGATGAGCAAGGAGG + Intergenic
1150608732 17:66716023-66716045 TCTAAAGCCAAGAAGCAATGGGG - Intronic
1155523966 18:26697709-26697731 TCTTATGCTAACAGGCAATGAGG + Intergenic
1156400880 18:36739080-36739102 GCTTATACCTATGAGCAATGAGG - Intronic
1156644787 18:39147964-39147986 TCTTATGCTGATGATCAATGAGG + Intergenic
1157076286 18:44471234-44471256 TCTTATGCCAATGAGTAATGAGG - Intergenic
1158185417 18:54765827-54765849 CCTTATCACAGTGAGCAATGGGG - Intronic
1158297710 18:56017023-56017045 TCTTATGAGAATGTGTAATGTGG + Intergenic
1158855203 18:61536870-61536892 TCTTATCCCAAGGAGCTATGAGG + Intronic
1158903469 18:61987829-61987851 TCTTGGGCCAAGGAACAATGTGG + Intergenic
1159184476 18:64950606-64950628 TCTTATGCTAATGAGCAATTAGG + Intergenic
1159246975 18:65819084-65819106 TCTTATGCCAATGAGCAATGAGG - Intronic
1160141027 18:76323302-76323324 TCTTAAGCCAATGTGAAATGGGG - Intergenic
1162001747 19:7748964-7748986 TCTTATGCCCACGAGCAATGAGG - Intergenic
1162852609 19:13442312-13442334 TGTTTTCCCACTGAGCAATGGGG + Intronic
1163614966 19:18321667-18321689 TGTTATCCCAAGGAGCAATTTGG - Intronic
1164149832 19:22541451-22541473 TCTTTAGCAAATGATCAATGGGG - Intergenic
1165134713 19:33660557-33660579 TTTTATGCTAATGGGCAATGAGG - Intronic
1166475122 19:43117480-43117502 TCTTATGATAATAAGTAATGAGG + Intronic
1166513319 19:43426058-43426080 TCTTGAGCTAATGAGCAATGAGG - Intergenic
1166652603 19:44585875-44585897 TCTTGTGCTAATGCACAATGAGG + Intergenic
926564429 2:14454263-14454285 TCTTATGCTAATGGGCAGTGAGG - Intergenic
928280855 2:29945049-29945071 TGTTATGCTAATGAGCAATGAGG - Intergenic
928346594 2:30503179-30503201 TCTTATGCTAATGGACAATGGGG + Intronic
928634224 2:33226748-33226770 CTTTATGCTAATGAGCAGTGAGG + Intronic
928788132 2:34915402-34915424 TCTTATGTCAATGAGCAATGAGG - Intergenic
930322935 2:49878342-49878364 TTTTATGCCCAGGAGCAATTTGG - Intergenic
930863687 2:56102350-56102372 TCTTGTGCTAATGAGCAATGAGG - Intergenic
931202967 2:60118227-60118249 TCTTATGCTAATCAGTAATGAGG + Intergenic
931965419 2:67528542-67528564 TCTTATGCTAATGAGCAATGAGG - Intergenic
932443470 2:71754869-71754891 TCATATGCCACTTAACAATGGGG - Intergenic
932749800 2:74364063-74364085 TCTTTTGCCTCAGAGCAATGGGG - Intronic
935713951 2:105923594-105923616 TCTGATGCCAATGAGCTTTCAGG - Intergenic
937171395 2:119873857-119873879 TCTTATATAAATGAGCATTGGGG - Intronic
939418422 2:141931938-141931960 TCTTTTTTCTATGAGCAATGAGG + Intronic
939626141 2:144479818-144479840 CCTTATGCAAATGAGCCCTGGGG - Intronic
941117287 2:161486916-161486938 TCTTAAGCCAAGGACCAATATGG + Intronic
943424636 2:187715550-187715572 CCTTATACTAATGAGCAATGAGG - Intergenic
943990603 2:194686173-194686195 TATTATGCAAAGAAGCAATGAGG - Intergenic
944326427 2:198410405-198410427 GCTGATTCCAATGAACAATGAGG + Intronic
1168908267 20:1423965-1423987 TCTTATGCTAATGAGCAGCAAGG - Intergenic
1168909402 20:1435113-1435135 TCATATGCTAATGAGCAATGAGG - Intergenic
1169035398 20:2447003-2447025 ATTTATGCTAATGAGCAACGAGG - Intergenic
1169501877 20:6168383-6168405 TCCCATGCTAATGAACAATGAGG + Intergenic
1171325027 20:24283574-24283596 TCTTATGCCAATGAGCTATAAGG + Intergenic
1172246795 20:33451007-33451029 CTTTATGCAAATGAGCAGTGAGG + Intergenic
1172570727 20:35968301-35968323 TCTTATGTTAATGAGGGATGGGG + Intronic
1173073121 20:39789166-39789188 TCTTATGCTTATGAGAAGTGTGG - Intergenic
1173308085 20:41871056-41871078 TCTTATGTTAATGAGCAATGAGG - Intergenic
1174429457 20:50457167-50457189 GCTCATGAAAATGAGCAATGGGG + Intergenic
1175569408 20:60007667-60007689 TCTTGCACCAGTGAGCAATGAGG + Intronic
1178026777 21:28477488-28477510 TCTCATGCTAATGAGCAATGAGG - Intergenic
1178042319 21:28652857-28652879 TCTTAGGCTAATGAGCAATGAGG - Intergenic
1179711131 21:43263874-43263896 TCTTATGCTGATGAGCACTTGGG + Intergenic
1184904579 22:47472341-47472363 TGTTATGCCCAGGAGCAATTTGG - Intronic
1185242806 22:49755547-49755569 TCTGATGCCAATGAGCAGTGAGG - Intergenic
950779398 3:15378386-15378408 TCCTATGCTAATGAGCAATGAGG + Intergenic
951934430 3:28005956-28005978 TGTGATGCCTGTGAGCAATGTGG - Intergenic
955208283 3:56917234-56917256 CCTTCTGCCAATGTGCAAGGAGG - Intronic
956489996 3:69760629-69760651 TCTTATACTGATGAGCAGTGAGG + Intronic
958966950 3:100569731-100569753 TTTTATGCCAAAGAGGAATAAGG - Intronic
959819116 3:110711292-110711314 TCTGATGCCATTGACCATTGGGG - Intergenic
959876831 3:111393019-111393041 TCTTATGTCAATGCGCAATGAGG - Intronic
961204451 3:125069722-125069744 TCTTTTTCTCATGAGCAATGAGG - Intergenic
964197315 3:154079649-154079671 TCTTATGCTAATGAGCTATAAGG + Intergenic
966064933 3:175808577-175808599 GCTTAAGCCAATAAGCACTGAGG + Intergenic
969218486 4:5743161-5743183 TCTTATGCTAATGAGCAATGAGG + Intronic
969589968 4:8116183-8116205 TCTTATGCCACTGAGGCTTGGGG + Intronic
969918337 4:10512082-10512104 TCTCATGCCTATGAGGAATCTGG + Intronic
971708663 4:30082601-30082623 TCTTAGTCCACTGAGAAATGTGG - Intergenic
971992384 4:33916085-33916107 TATCATGCTAATGAGCAATGAGG - Intergenic
972910611 4:43812044-43812066 TCTTATTCCAACAAGTAATGTGG - Intergenic
974562681 4:63541811-63541833 TCTTCTGCACATGAGAAATGGGG - Intergenic
974836443 4:67256827-67256849 TCTTATGCTAATGAGCAAGGAGG + Intergenic
977825257 4:101523807-101523829 TCTTATGCTAATGAGCAATGAGG - Intronic
979588898 4:122454755-122454777 TCTTTTGTAAATGTGCAATGAGG + Intronic
979773934 4:124563646-124563668 TATTATTCCTATGAGCAATTGGG - Intergenic
981676302 4:147346974-147346996 TCTTGAGCAAATGAGCTATGAGG + Intergenic
982371879 4:154642588-154642610 TCTTATGCCAATAAGCAATGAGG - Intronic
982788203 4:159560230-159560252 TGTTATCCCCAAGAGCAATGTGG + Intergenic
982893062 4:160880422-160880444 CTTTATGCTAATGAGCAGTGAGG - Intergenic
985136676 4:186793128-186793150 TCTTATGCAACTAAGCAATGAGG + Intergenic
985998234 5:3609413-3609435 TCTTAGCCCAGGGAGCAATGAGG - Intergenic
986127995 5:4901460-4901482 TGTTATGCCCCAGAGCAATGAGG - Intergenic
986209483 5:5657231-5657253 TCCTATGCTAATGAACAATGAGG - Intergenic
987235455 5:15937329-15937351 TCTGTTGCCCATGAGAAATGAGG - Exonic
988293743 5:29327162-29327184 TCTTATGCCTATGTGCATCGTGG + Intergenic
988936661 5:36090200-36090222 TCTTCTGCTAATGAGCAAAGAGG + Intergenic
989311344 5:40022267-40022289 TCTTATGCTAATGAGCAATGAGG + Intergenic
990395252 5:55371524-55371546 TCCTATGGCAATGACCCATGAGG + Intronic
992308680 5:75471143-75471165 TCTTGTGTCACTTAGCAATGGGG + Intronic
992593520 5:78321613-78321635 GCTGATGCCAATGATCATTGTGG + Intergenic
995963402 5:117873233-117873255 CTTTATGCTAATGAGCAGTGAGG + Intergenic
996576124 5:124977907-124977929 TGTTATGTCAATGATAAATGTGG + Intergenic
996955538 5:129178864-129178886 TATTATCCCAAAGAGCAATTTGG + Intergenic
997065309 5:130553081-130553103 TCCTATGCCACTGAGCAATGAGG - Intergenic
997065436 5:130554077-130554099 TCTTATGCTAATGAGTAATGAGG - Intergenic
998323063 5:141250798-141250820 TCTTATGCTAATGAGCAGTAAGG - Intergenic
999674706 5:153987408-153987430 TCTTATGCCAATGAGCAATGAGG + Intergenic
1003043792 6:2714217-2714239 TGTTATGCTAATGAGCAATGGGG - Intronic
1005132236 6:22522494-22522516 TCTTATGCCAAACAGCAATATGG - Intergenic
1006199652 6:32276759-32276781 TCTTATACTAATGAGTAGTGGGG + Intergenic
1008206939 6:48671713-48671735 TCTTATGCCAATGAGCAATAAGG + Intergenic
1009370492 6:62894523-62894545 TTTTATGCTAATAACCAATGGGG + Intergenic
1009721343 6:67474433-67474455 TTTTATGCTATGGAGCAATGGGG + Intergenic
1009832583 6:68957183-68957205 TCCTTTGCCAATGAAAAATGGGG - Intronic
1010616583 6:78020420-78020442 TCTTATGCTAATAAGCCATGAGG - Intergenic
1010774002 6:79864408-79864430 TCTTATCCCAAGGAGGTATGAGG - Intergenic
1010866583 6:80983190-80983212 TCTTATGCCAAAGAGCCATGAGG - Intergenic
1013376746 6:109524091-109524113 TATTATTACAATGATCAATGAGG + Intronic
1013420665 6:109963775-109963797 TCTCATGCCAATGAGTAATGAGG - Intergenic
1018415592 6:163599819-163599841 TCTTATGCCAATGAGCAGTGAGG - Intergenic
1018623246 6:165751688-165751710 TCTTATGCTGATGAGCAATCAGG - Intronic
1019954341 7:4401472-4401494 TCTTATGCCAATGAGCAATGAGG + Intergenic
1019962178 7:4469979-4470001 TCCCATGCCAATGAACAACGGGG - Intergenic
1021542927 7:21780409-21780431 TGTTATTCCATTGAGCAATTAGG + Intronic
1021656641 7:22880254-22880276 TCTGATGCCCATCAGAAATGGGG + Intergenic
1022873260 7:34501738-34501760 TCTGATGCCAATTAGCACTGTGG + Intergenic
1023015035 7:35958762-35958784 TCATATGTCACTTAGCAATGGGG + Intergenic
1024065910 7:45735938-45735960 TCATATGTCACTTAGCAATGGGG - Intergenic
1024780877 7:52846891-52846913 TCTTATACCAATGAGTAATGAGG - Intergenic
1025245221 7:57312019-57312041 GCTTGTGAAAATGAGCAATGAGG - Intergenic
1027775456 7:82458978-82459000 TCTTTTGCAAATGAGAATTGTGG - Intergenic
1028317928 7:89427212-89427234 TCTTATGCCATTGAGCAATGAGG + Intergenic
1029597989 7:101547637-101547659 TCTTCCCCCAATGAGGAATGTGG - Intronic
1029817956 7:103115983-103116005 TCTTAGGCTAATGAGCAATGAGG + Intronic
1030640615 7:112001985-112002007 TTTTTTGCCAATGAGCAAAATGG - Intronic
1030766517 7:113416749-113416771 TCTGAAGTCCATGAGCAATGTGG - Intergenic
1031668151 7:124510975-124510997 TCTTATATTAATGAGCAATGAGG + Intergenic
1032285031 7:130533328-130533350 TCCTATGCCAAGGACCAATAAGG + Intronic
1033192435 7:139294108-139294130 TCTGTTGCTAATGAGGAATGAGG - Intronic
1034110016 7:148527745-148527767 TCTTATGCTAATGAGCAGCAAGG + Intergenic
1035978516 8:4340619-4340641 TCCTCTGCCAATGAGCCAAGTGG + Intronic
1036508946 8:9382814-9382836 CCTTCTACCAAGGAGCAATGGGG + Intergenic
1037062598 8:14533455-14533477 TTCTATGCTAATGAGGAATGTGG + Intronic
1038080977 8:24135773-24135795 TCTTATTCCACTGAGGAATATGG - Intergenic
1042811134 8:72826395-72826417 TTTTATGCCTATGAACAATAAGG + Intronic
1043139947 8:76575607-76575629 ACTTAAGCCAAAAAGCAATGTGG + Intergenic
1043375993 8:79650525-79650547 TCTAATTCCAATGAGCAAATAGG - Intronic
1044155705 8:88843743-88843765 TCTGATGCTAATGAGCAATGAGG + Intergenic
1044468739 8:92540118-92540140 TCCTTTTCCAATGAGAAATGAGG + Intergenic
1044822408 8:96163269-96163291 CCTTCTGCAAATGAGAAATGGGG - Intergenic
1045532915 8:103001454-103001476 TCTTATGCAAATAACCAATTAGG - Intergenic
1046112738 8:109745794-109745816 TCTTCTACCAATGAGCAAACAGG - Intergenic
1048970086 8:139640518-139640540 TCTGATGCTAATGAGCAGGGGGG - Intronic
1049012240 8:139894795-139894817 TCGTGTGCCCATGAGCCATGAGG - Intronic
1050994657 9:12200969-12200991 TCTTATGCCAATAAGCAATGAGG - Intergenic
1051011184 9:12416378-12416400 TCTTATGCTAATGAGAAATAAGG + Intergenic
1052247969 9:26361399-26361421 TCTTATGCTAATGAGCAATGAGG - Intergenic
1055079507 9:72255340-72255362 TCTTATGCTAATGAGCAATGAGG + Intronic
1055325793 9:75127470-75127492 TCATATTCTAATAAGCAATGTGG - Intronic
1056111181 9:83396576-83396598 GCTTAGGCCAATGAGACATGAGG + Intronic
1057971232 9:99560134-99560156 GATTATGCCAAGGACCAATGAGG + Intergenic
1058310651 9:103497347-103497369 TCTTATGCTAATGAGTAATGAGG + Intergenic
1058792833 9:108468559-108468581 TATTATGCTAATGAGCAATGAGG - Intergenic
1059399510 9:114060096-114060118 TGTGATGACAATGAACAATGAGG + Intergenic
1060752608 9:126183350-126183372 TTTTATGCAAATGAACAGTGAGG + Intergenic
1187056630 X:15746911-15746933 TGTTATCCCAAGGAGCAATTTGG + Intronic
1188187632 X:27134529-27134551 TCTTATGCTAAAAAGCAATGAGG - Intergenic
1189505491 X:41609456-41609478 CCTTAAGCCTATGAGAAATGTGG - Intronic
1189650890 X:43188358-43188380 TCTTATGCTAATGAGCAATGAGG - Intergenic
1190406673 X:50095013-50095035 TCTTTTGCCATTGAGGTATGTGG - Exonic
1190682444 X:52839260-52839282 TCCCATGCTAATAAGCAATGAGG + Intergenic
1190953298 X:55167310-55167332 TCTCATGCTAATAAGCAATAAGG - Intronic
1190999014 X:55639271-55639293 TCATGTGCTAGTGAGCAATGAGG + Intergenic
1190999096 X:55640967-55640989 TCCCATGCTAATAAGCAATGAGG + Intergenic
1191722893 X:64249243-64249265 CCTTATGGGGATGAGCAATGGGG - Intergenic
1194151943 X:90337177-90337199 TCTTATGCTAATGAGCAATGAGG + Intergenic
1194152808 X:90345843-90345865 TCTTATGCTAATGAGCAATGTGG + Intergenic
1195389237 X:104343836-104343858 TCTTATGTTAATGAACAATGAGG + Intergenic
1196459603 X:115916734-115916756 TCTTATGCAAATAACCAATTAGG + Intergenic
1197176950 X:123496135-123496157 TCTTGTGCCAAAGAGCAATAGGG - Intergenic
1197221399 X:123917214-123917236 TGTAATGGCAATGAGCAATGTGG - Intergenic
1198271321 X:135058900-135058922 TCTTATGCTGATGGGCAGTGAGG - Intergenic
1199716936 X:150513465-150513487 TTTTAATGCAATGAGCAATGTGG + Intronic
1200353529 X:155524715-155524737 TCTTCTACCAATAAGCAATAAGG + Intronic
1200498303 Y:3913943-3913965 TCTTATGCTAATGAGCAATGAGG + Intergenic
1200499152 Y:3922588-3922610 TCTTATGCTAATGAGCAATGTGG + Intergenic