ID: 1019954342

View in Genome Browser
Species Human (GRCh38)
Location 7:4401473-4401495
Sequence CTTATGCCAATGAGCAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 7, 1: 23, 2: 46, 3: 46, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019954336_1019954342 30 Left 1019954336 7:4401420-4401442 CCTGCAAATTAAGGGGTAGGTCA No data
Right 1019954342 7:4401473-4401495 CTTATGCCAATGAGCAATGAGGG 0: 7
1: 23
2: 46
3: 46
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019954342 Original CRISPR CTTATGCCAATGAGCAATGA GGG Intergenic
902260097 1:15218691-15218713 CCCATGCTGATGAGCAATGAGGG - Intronic
906234397 1:44195755-44195777 CTTATGCTAATGAGAAATGAGGG - Intergenic
906264864 1:44420992-44421014 CTTATGGCAATGTGGAAAGAGGG + Intronic
906499857 1:46333710-46333732 CTTATGCTAATGACCAGTGAGGG - Intergenic
906717091 1:47978412-47978434 CTAAGGCCAAGGAGCGATGATGG + Intronic
907026432 1:51124764-51124786 CTTGTATTAATGAGCAATGAAGG + Intronic
908083991 1:60610899-60610921 CTTATTTCCATCAGCAATGAGGG + Intergenic
908972953 1:69859572-69859594 CTGATGGCAATTAGCAATAATGG + Intronic
909051917 1:70776710-70776732 CTTATGCTAACGAGCAATGAGGG - Intergenic
909635097 1:77808735-77808757 CCTTGGCCAGTGAGCAATGAAGG + Intronic
909971290 1:81993571-81993593 TTGATGCCAAAGATCAATGATGG - Intergenic
910034543 1:82775625-82775647 CTTATGCTAATGAGCAGCGCGGG - Intergenic
913017048 1:114748584-114748606 CCTATTCCTATGAACAATGAAGG + Intronic
913403157 1:118458201-118458223 CTTATGCCCTTGAGAAAAGAGGG - Intergenic
913659699 1:120995215-120995237 TTTATGCTAATGAGCAGTGAGGG + Intergenic
914386977 1:147179218-147179240 CCTATCCCAGAGAGCAATGATGG + Intronic
914649680 1:149686994-149687016 TTTATGCTAATGAGCAGTGAGGG + Intergenic
917613913 1:176717291-176717313 TTTATGCTAATGAGCAGTTAGGG - Intronic
918237885 1:182597964-182597986 CTCATGCCTGTGAGCACTGAGGG - Intergenic
918682409 1:187371911-187371933 CTTATACTAATGAGCAATGAGGG - Intergenic
918682521 1:187372882-187372904 CTTATGCTAATGAGGAATGAGGG + Intergenic
918918005 1:190670189-190670211 TTTAGGCCAATGGGCTATGAAGG - Intergenic
921802428 1:219416763-219416785 CTTATGCTAGTGAGCAGTAAGGG + Intergenic
922968591 1:229715200-229715222 CTCATGCTAATGAGCAATGAGGG - Intergenic
923202439 1:231725379-231725401 CTTATGCTAATGAGCAATAAGGG - Intronic
924273028 1:242354161-242354183 CTTATGCCTATGAGCAAGGAGGG - Intronic
1063274421 10:4549270-4549292 CTTATGCTAATGAGCAGTGGGGG - Intergenic
1063850016 10:10177282-10177304 ATGATACAAATGAGCAATGAAGG - Intergenic
1063965951 10:11345951-11345973 CTTATGTGAATGAGCAATGAGGG + Intergenic
1063966848 10:11352661-11352683 CTTATGCTAATGAGCAGTGAGGG + Intergenic
1063966926 10:11353394-11353416 CTTATGCTAATGAGCAATGAGGG - Intergenic
1064461695 10:15540866-15540888 CTTATGCTGATGAGCAATGAAGG - Intronic
1066017658 10:31264185-31264207 CTTAAACCAATGAGTTATGAGGG + Intergenic
1066711684 10:38242498-38242520 CTTATGCCTATGAGCAAGGAGGG + Intergenic
1067246883 10:44554859-44554881 CTGGTGCCATTGAGCAATGCTGG - Intergenic
1070181500 10:74018406-74018428 CTGATGCCAAGGAGCAAACATGG + Intronic
1072320679 10:94246639-94246661 ATTATGCCAGTGAGGAAAGAGGG - Intronic
1072799230 10:98381285-98381307 CTTATACTAATTAGCAATCAAGG + Intergenic
1073182150 10:101590304-101590326 CTTTTCTCAAGGAGCAATGAGGG + Intronic
1075063055 10:119270069-119270091 TGAATGCCAATGAGCAGTGAAGG - Intronic
1075363611 10:121862806-121862828 CTTATGCCAATGAACAGCAAGGG - Intronic
1075528879 10:123210209-123210231 CTTATGCAAACCAGCCATGATGG - Intergenic
1076200581 10:128554579-128554601 CTTATGCTAATGAGCAATGAGGG + Intergenic
1077983133 11:7321908-7321930 ATGATGTAAATGAGCAATGAGGG + Intronic
1078982594 11:16553515-16553537 CTTATGCTAATGAACAATGAGGG + Intronic
1079765468 11:24386856-24386878 CTTAGGACAAAGAACAATGATGG + Intergenic
1081406631 11:42706179-42706201 CTTATGCAAACTATCAATGATGG - Intergenic
1083543510 11:63531593-63531615 CTTATGCTAATGAGCAGTGAGGG + Intergenic
1083700319 11:64473117-64473139 CTTATGCTAATGAGCCCTGAGGG - Intergenic
1083791319 11:64988193-64988215 CCTAGTCCAAAGAGCAATGAGGG + Exonic
1083909910 11:65700627-65700649 CTTATGCTAAGGAACAATGAGGG + Intergenic
1083915741 11:65742543-65742565 CTTATGCTAATGAATAATGAGGG + Intergenic
1085405610 11:76260050-76260072 CTGAGGGCAATGAGCAATGAGGG + Intergenic
1086554440 11:88092073-88092095 CGTATGGCAGTGATCAATGAGGG + Intergenic
1088380220 11:109184516-109184538 ATTATGCTAATGAGCAATGAGGG + Intergenic
1089841127 11:121418727-121418749 TTTATGCTAAGGAGCAGTGAGGG - Intergenic
1090465773 11:126931772-126931794 CTTATGGCAAAGAGAAAAGATGG + Intronic
1090557260 11:127889907-127889929 GTTATACCAATGAGCAAGCAAGG + Intergenic
1091667108 12:2427178-2427200 CCTGTGCCAATCTGCAATGAAGG + Intronic
1093818112 12:23575370-23575392 CTAATCGCAGTGAGCAATGATGG - Intronic
1094246675 12:28304690-28304712 CTGATGCCAATGTGGAATAAAGG + Intronic
1099562469 12:84195240-84195262 CTTATGCTAATGAGTAACGAGGG - Intergenic
1099839158 12:87944124-87944146 CTTATGCTAATGGACAATAAGGG + Intergenic
1099949314 12:89282761-89282783 CTTAGTTCAATTAGCAATGATGG - Intergenic
1101530476 12:105568878-105568900 CTTATGTTAATGAGCAATGAGGG + Intergenic
1104434264 12:128743260-128743282 CTTATGCCAATGAGCAATGAGGG - Intergenic
1104521461 12:129479447-129479469 CGTATGCCAGAGAGCAATGAAGG - Intronic
1105672002 13:22629530-22629552 TTTATGCTAATGAGCAGTGAGGG - Intergenic
1105796280 13:23856624-23856646 ATTATGCTAATGAGTAGTGAGGG + Intronic
1106813348 13:33381333-33381355 CTTATGCTAATAGGCAATAAGGG + Intergenic
1108048435 13:46405608-46405630 CTTATGCTAATGAGCAGCTAGGG - Intronic
1108376797 13:49821601-49821623 CTTATGCTAATGAGCAATGAGGG - Intergenic
1108583837 13:51850463-51850485 CTTACATCAATGAGCAATTATGG + Intergenic
1108862967 13:54884844-54884866 CCTATGCTAATGAGCAATAAGGG - Intergenic
1109587932 13:64434187-64434209 CTGAAGACAATGAGCAAAGAAGG + Intergenic
1110247512 13:73342974-73342996 CTTTTGCCACTGAGCAGTGGTGG - Intergenic
1111179614 13:84645896-84645918 CTTCTGCTAATGAGCAATGAGGG + Intergenic
1112582507 13:100688581-100688603 CTTATGCTAATGAGCAATGAGGG + Intergenic
1112583595 13:100697308-100697330 CTTATACTAATGAGCAATGAGGG + Intergenic
1112751509 13:102588476-102588498 TTTATGTCAATGAGCAATGAGGG + Intergenic
1112966112 13:105196203-105196225 CTTATGCTAATGAGCAATGAGGG + Intergenic
1113027839 13:105960511-105960533 CTGATTCTAATGAGTAATGAAGG - Intergenic
1114850661 14:26379020-26379042 CTCATGCTAATGAGCAATGAGGG + Intergenic
1115139316 14:30151008-30151030 CTTACGCTAATGAGCAATGAGGG - Intronic
1116239237 14:42320196-42320218 CTTATGTGAATGAGCAATGAGGG + Intergenic
1116259420 14:42603568-42603590 CTTATGCTAATGAGCAATGAGGG + Intergenic
1116407097 14:44579501-44579523 CTTAAGTCAATTTGCAATGAAGG - Intergenic
1117021285 14:51573372-51573394 CTTATGCCAATGAGAGACAAAGG + Intronic
1117668302 14:58080012-58080034 CTACTGCAGATGAGCAATGAGGG - Intronic
1120123997 14:80719080-80719102 CTTATGCCAATGAGCAATGAGGG - Intronic
1120814758 14:88844373-88844395 TATATGCAAATGAGCAATAATGG + Intronic
1121514018 14:94536991-94537013 CTTATGCTGATGAGCAGTGAGGG + Intergenic
1121562787 14:94887165-94887187 CTTCAGTCACTGAGCAATGAGGG + Intergenic
1121773471 14:96573768-96573790 TTTAAGCCAATGAGCGCTGAAGG - Intergenic
1124440509 15:29682320-29682342 CTTGTGCTAATGGACAATGAGGG - Intergenic
1125540704 15:40468338-40468360 CCAAGGCCAATGAGCAAAGAGGG + Intergenic
1125952880 15:43768565-43768587 CCTATCCCAGAGAGCAATGATGG + Exonic
1129985310 15:79914455-79914477 ATAATGACAATGAGCAATTAAGG + Intronic
1131404262 15:92151241-92151263 CTTATGCCGATGAGAATTCACGG - Intronic
1134540593 16:15061652-15061674 CTTGTGCCATTGGGCATTGATGG - Exonic
1135162280 16:20107530-20107552 CTTAAGCCAATCAGAGATGAGGG - Intergenic
1135413244 16:22250656-22250678 CTTCGGCCGAGGAGCAATGAGGG + Exonic
1136358453 16:29761932-29761954 CTTACCCTAATGAGCAATGAGGG - Intergenic
1138777458 16:59741061-59741083 CTTATGCCTATGAGGAATGAGGG + Intronic
1138859269 16:60735782-60735804 CTCATGCTGATGAGCAATGAGGG - Intergenic
1139102920 16:63789757-63789779 CTTATGCTAATTAGCAGTGAGGG + Intergenic
1139179612 16:64731084-64731106 ATGATGCCAATGAGCAGTCAAGG - Intergenic
1139681781 16:68570606-68570628 CTTACGCTAATGAGCAACGAAGG + Intronic
1140300563 16:73753327-73753349 CTCATGCAAGTGAGCAATGAGGG - Intergenic
1140614176 16:76640093-76640115 CCCAGGCCAGTGAGCAATGAGGG + Intergenic
1143806765 17:9434953-9434975 TTTATGTTAATGAGCAGTGAGGG + Intronic
1144281117 17:13727434-13727456 CTAATATTAATGAGCAATGAGGG + Intergenic
1144303079 17:13941458-13941480 CTTATGCCAATGAGTAATGAGGG + Intergenic
1144424837 17:15132138-15132160 CTTACACCAATGAGCAATGAGGG - Intergenic
1146087956 17:29847762-29847784 TCCATGCTAATGAGCAATGAGGG - Intronic
1146252524 17:31361478-31361500 ATTATGACAGTGAGTAATGAAGG + Intronic
1151905442 17:77045464-77045486 CTTATGCTATTGAGCGACGAGGG - Intergenic
1153574450 18:6506750-6506772 CTTATGCACATGAGTAATAAAGG - Intergenic
1153813903 18:8776544-8776566 CTTATTCCCATGTGAAATGAAGG - Intronic
1155523967 18:26697710-26697732 CTTATGCTAACAGGCAATGAGGG + Intergenic
1156400879 18:36739079-36739101 CTTATACCTATGAGCAATGAGGG - Intronic
1156644788 18:39147965-39147987 CTTATGCTGATGATCAATGAGGG + Intergenic
1157076285 18:44471233-44471255 CTTATGCCAATGAGTAATGAGGG - Intergenic
1159002604 18:62987471-62987493 CACATGCCCATTAGCAATGAGGG + Intergenic
1159124133 18:64203254-64203276 CTTATCCCGTTAAGCAATGATGG + Intergenic
1159184477 18:64950607-64950629 CTTATGCTAATGAGCAATTAGGG + Intergenic
1159246974 18:65819083-65819105 CTTATGCCAATGAGCAATGAGGG - Intronic
1159712894 18:71784927-71784949 TTTATTCTAATGAGCAGTGAGGG + Intronic
1160141026 18:76323301-76323323 CTTAAGCCAATGTGAAATGGGGG - Intergenic
1165134712 19:33660556-33660578 TTTATGCTAATGGGCAATGAGGG - Intronic
1166475123 19:43117481-43117503 CTTATGATAATAAGTAATGAGGG + Intronic
1166513318 19:43426057-43426079 CTTGAGCTAATGAGCAATGAGGG - Intergenic
1166652604 19:44585876-44585898 CTTGTGCTAATGCACAATGAGGG + Intergenic
1168158827 19:54494479-54494501 CTCATGTAAATGACCAATGAGGG - Intergenic
925061998 2:898511-898533 TTTATGCAAATGAGTACTGAGGG + Intergenic
927046364 2:19282974-19282996 CTTATGCAGATGGGTAATGATGG - Intergenic
928280854 2:29945048-29945070 GTTATGCTAATGAGCAATGAGGG - Intergenic
928346595 2:30503180-30503202 CTTATGCTAATGGACAATGGGGG + Intronic
928634225 2:33226749-33226771 TTTATGCTAATGAGCAGTGAGGG + Intronic
928788131 2:34915401-34915423 CTTATGTCAATGAGCAATGAGGG - Intergenic
930863686 2:56102349-56102371 CTTGTGCTAATGAGCAATGAGGG - Intergenic
931403001 2:61949163-61949185 GTTATGCCAATAAGAAAGGAAGG + Intronic
936856746 2:116967322-116967344 CATATGCCACTTTGCAATGAAGG + Intergenic
939572168 2:143853245-143853267 ATTATGTCAATGAGCAGTAATGG + Intergenic
940478765 2:154201439-154201461 CTTATACCTATTAGCAATCATGG + Intronic
941275685 2:163487960-163487982 ATAATACCAAAGAGCAATGATGG - Intergenic
942950869 2:181720132-181720154 CTTAAGCCAATTAGATATGATGG + Intergenic
943424635 2:187715549-187715571 CTTATACTAATGAGCAATGAGGG - Intergenic
944326428 2:198410406-198410428 CTGATTCCAATGAACAATGAGGG + Intronic
945061318 2:205911337-205911359 ATCATGCCAATGAGCAACCATGG + Intergenic
945692725 2:213060656-213060678 CATATGCTAATAAGCAATAATGG + Intronic
1168908266 20:1423964-1423986 CTTATGCTAATGAGCAGCAAGGG - Intergenic
1168909401 20:1435112-1435134 CATATGCTAATGAGCAATGAGGG - Intergenic
1169035397 20:2447002-2447024 TTTATGCTAATGAGCAACGAGGG - Intergenic
1169501879 20:6168384-6168406 CCCATGCTAATGAACAATGAGGG + Intergenic
1172062102 20:32193617-32193639 CATATGACAAAGACCAATGAGGG - Exonic
1172246796 20:33451008-33451030 TTTATGCAAATGAGCAGTGAGGG + Intergenic
1172913068 20:38424505-38424527 CTTATCCCATTGAGCAGTGCTGG - Intergenic
1173308084 20:41871055-41871077 CTTATGTTAATGAGCAATGAGGG - Intergenic
1174140762 20:48412116-48412138 TTTATGCTATTGAGCAGTGAGGG - Intergenic
1174429458 20:50457168-50457190 CTCATGAAAATGAGCAATGGGGG + Intergenic
1175569409 20:60007668-60007690 CTTGCACCAGTGAGCAATGAGGG + Intronic
1177355745 21:20004554-20004576 CTTATCCTAATGAGAAATGAAGG - Intergenic
1177366851 21:20151050-20151072 TTTTTTCCAATGAGCAATGCAGG + Intergenic
1178042318 21:28652856-28652878 CTTAGGCTAATGAGCAATGAGGG - Intergenic
1183747010 22:39697860-39697882 CTTCTGCGAATGAGGAATGGAGG + Intergenic
1185242805 22:49755546-49755568 CTGATGCCAATGAGCAGTGAGGG - Intergenic
950132114 3:10554361-10554383 CTTATGGCAAAGGGAAATGAGGG + Intronic
950779400 3:15378387-15378409 CCTATGCTAATGAGCAATGAGGG + Intergenic
955208282 3:56917233-56917255 CTTCTGCCAATGTGCAAGGAGGG - Intronic
955560315 3:60182142-60182164 TTTATGCTAATGAGCAATGAAGG + Intronic
956489997 3:69760630-69760652 CTTATACTGATGAGCAGTGAGGG + Intronic
957550711 3:81699893-81699915 CTTATGTCAATGAGGCATGAAGG - Intronic
959464916 3:106673759-106673781 CTTAAGCCAATGAACACTGCAGG + Intergenic
959770655 3:110091058-110091080 CTTATGCTAATGAGCAATGACGG + Intergenic
959876830 3:111393018-111393040 CTTATGTCAATGCGCAATGAGGG - Intronic
960977126 3:123186220-123186242 CTTACCCCATTGAGCAGTGATGG - Intronic
962387748 3:134946399-134946421 CTGGTGCCATTGAGGAATGAAGG - Intronic
963621657 3:147615206-147615228 CTTGTGCAAATGAGCCATAATGG - Intergenic
964197316 3:154079650-154079672 CTTATGCTAATGAGCTATAAGGG + Intergenic
965533284 3:169798367-169798389 ATAATGCCAATGAGCATTAAAGG + Intronic
969049215 4:4360742-4360764 CTTTTGCGAAAGAGCACTGAGGG + Intronic
969191547 4:5525075-5525097 TTTATGCTAATGAGTAGTGAGGG + Intronic
969211408 4:5690456-5690478 CTGATGCCAATGAGTTGTGATGG + Intronic
969218487 4:5743162-5743184 CTTATGCTAATGAGCAATGAGGG + Intronic
971992383 4:33916084-33916106 ATCATGCTAATGAGCAATGAGGG - Intergenic
974836444 4:67256828-67256850 CTTATGCTAATGAGCAAGGAGGG + Intergenic
975628145 4:76370604-76370626 CTTCAGGCAATGAGTAATGAGGG + Intronic
976367531 4:84247042-84247064 CATATGACAAAGACCAATGAGGG + Intergenic
977728993 4:100329674-100329696 ATTATGCCAATGATCATTGATGG + Intergenic
977825256 4:101523806-101523828 CTTATGCTAATGAGCAATGAGGG - Intronic
979415591 4:120434414-120434436 CTTGTGCCAATGTGTAAAGATGG - Intergenic
979588899 4:122454756-122454778 CTTTTGTAAATGTGCAATGAGGG + Intronic
982371878 4:154642587-154642609 CTTATGCCAATAAGCAATGAGGG - Intronic
982408673 4:155047850-155047872 CTCATGCCACTTAGAAATGAGGG + Intergenic
982893061 4:160880421-160880443 TTTATGCTAATGAGCAGTGAGGG - Intergenic
984127011 4:175823905-175823927 CTTCTCCCAATGGGCAATCAAGG + Intronic
985016176 4:185638386-185638408 CTTATGCCAATCAGAAACGATGG - Intronic
985136677 4:186793129-186793151 CTTATGCAACTAAGCAATGAGGG + Intergenic
985701411 5:1375339-1375361 CTTATGCCAATGAGCAATGATGG - Intergenic
985998233 5:3609412-3609434 CTTAGCCCAGGGAGCAATGAGGG - Intergenic
986209481 5:5657230-5657252 CCTATGCTAATGAACAATGAGGG - Intergenic
987883555 5:23782056-23782078 CTTATGGAAAAGAGCAAGGAAGG + Intergenic
990933747 5:61123738-61123760 TTTATTACAATTAGCAATGAAGG + Intronic
991492357 5:67195571-67195593 ATCATGCCAATGAGAAATGAAGG - Intronic
991534394 5:67650718-67650740 CTTAGGCTGATGAGCAATGTTGG + Intergenic
995963403 5:117873234-117873256 TTTATGCTAATGAGCAGTGAGGG + Intergenic
996787916 5:127260461-127260483 GTTATGACAATGAGACATGAAGG - Intergenic
997065307 5:130553080-130553102 CCTATGCCACTGAGCAATGAGGG - Intergenic
997065435 5:130554076-130554098 CTTATGCTAATGAGTAATGAGGG - Intergenic
997778490 5:136633141-136633163 CTTATTCCATTGAACAGTGAGGG - Intergenic
998323062 5:141250797-141250819 CTTATGCTAATGAGCAGTAAGGG - Intergenic
998517293 5:142768171-142768193 TCTATGCTAATGAGCAGTGAGGG + Intergenic
999674707 5:153987409-153987431 CTTATGCCAATGAGCAATGAGGG + Intergenic
999845985 5:155480795-155480817 CTTTTGCCAGTGAGGAATTATGG - Intergenic
1002653237 5:180719714-180719736 CTTCTGCCACTCAGCAAAGAAGG + Intergenic
1007915273 6:45555802-45555824 CTCATGCCCACGAGGAATGACGG - Intronic
1008206940 6:48671714-48671736 CTTATGCCAATGAGCAATAAGGG + Intergenic
1010616582 6:78020419-78020441 CTTATGCTAATAAGCCATGAGGG - Intergenic
1010774001 6:79864407-79864429 CTTATCCCAAGGAGGTATGAGGG - Intergenic
1010866582 6:80983189-80983211 CTTATGCCAAAGAGCCATGAGGG - Intergenic
1012297107 6:97538496-97538518 ATTATGACTATGAGTAATGAAGG - Intergenic
1013091711 6:106906252-106906274 TTTATACCAATAAGCAATCAAGG + Intergenic
1013420664 6:109963774-109963796 CTCATGCCAATGAGTAATGAGGG - Intergenic
1018415591 6:163599818-163599840 CTTATGCCAATGAGCAGTGAGGG - Intergenic
1018623245 6:165751687-165751709 CTTATGCTGATGAGCAATCAGGG - Intronic
1018660436 6:166081324-166081346 CTTATGACAATGTGGCATGAAGG - Intergenic
1019029115 6:168995194-168995216 CTTATGCCAATGAGTAATGACGG + Intergenic
1019954342 7:4401473-4401495 CTTATGCCAATGAGCAATGAGGG + Intergenic
1020727188 7:11831062-11831084 ATTTTGCCAATGGGTAATGATGG + Intronic
1024435016 7:49342047-49342069 CTTATGCTAATGAGCAGGAAGGG - Intergenic
1024780876 7:52846890-52846912 CTTATACCAATGAGTAATGAGGG - Intergenic
1025245220 7:57312018-57312040 CTTGTGAAAATGAGCAATGAGGG - Intergenic
1025711493 7:63914373-63914395 CCTATGCCAAGGAGAAAGGAAGG - Intergenic
1028317929 7:89427213-89427235 CTTATGCCATTGAGCAATGAGGG + Intergenic
1029327399 7:99822160-99822182 CTAATGACAGTGAGCAATGGAGG + Intergenic
1029817957 7:103115984-103116006 CTTAGGCTAATGAGCAATGAGGG + Intronic
1030542567 7:110850269-110850291 CTTATGCCAATGAGCAATGAAGG - Intronic
1030776743 7:113543160-113543182 CTTATGCTAATGAGGAATGAAGG - Intergenic
1031668152 7:124510976-124510998 CTTATATTAATGAGCAATGAGGG + Intergenic
1033711586 7:143951555-143951577 CCTATTCCAATGAGCAGTTATGG - Intergenic
1034110017 7:148527746-148527768 CTTATGCTAATGAGCAGCAAGGG + Intergenic
1036913041 8:12774941-12774963 TTTATGCTAATGAACAGTGAGGG - Intergenic
1042700720 8:71610654-71610676 CTTATTCCAGTGAGAATTGATGG + Intergenic
1043139948 8:76575608-76575630 CTTAAGCCAAAAAGCAATGTGGG + Intergenic
1043627515 8:82280655-82280677 CAAATGCCAATGTGCCATGAAGG + Intergenic
1044155706 8:88843744-88843766 CTGATGCTAATGAGCAATGAGGG + Intergenic
1044217378 8:89628226-89628248 CTCCTGCTAATGGGCAATGATGG - Intergenic
1045764069 8:105646403-105646425 CTAATGACAATTAGCGATGAGGG + Intronic
1048326574 8:133443732-133443754 CTTAAGCAACCGAGCAATGATGG + Intergenic
1049012239 8:139894794-139894816 CGTGTGCCCATGAGCCATGAGGG - Intronic
1050994656 9:12200968-12200990 CTTATGCCAATAAGCAATGAGGG - Intergenic
1051009514 9:12394291-12394313 TGTATGCTAATAAGCAATGAGGG + Intergenic
1051010232 9:12403648-12403670 ATTTTGCCAATGAGGAATCATGG - Intergenic
1051011185 9:12416379-12416401 CTTATGCTAATGAGAAATAAGGG + Intergenic
1052247968 9:26361398-26361420 CTTATGCTAATGAGCAATGAGGG - Intergenic
1052565141 9:30140338-30140360 CTTATGCTAATGAGTAATGAAGG - Intergenic
1052984764 9:34478780-34478802 CTTATGCTATTGACCAAAGAAGG - Intronic
1055079508 9:72255341-72255363 CTTATGCTAATGAGCAATGAGGG + Intronic
1056244083 9:84677097-84677119 CTAATGCCAATCTGCAAAGATGG - Intronic
1056930722 9:90874450-90874472 CACATGCCCATGAGCAGTGATGG + Intronic
1057001062 9:91509696-91509718 CTGGTGGCAATGATCAATGAAGG - Intergenic
1058792832 9:108468558-108468580 ATTATGCTAATGAGCAATGAGGG - Intergenic
1060277657 9:122194043-122194065 GTTATCCCAATGACCTATGAGGG + Intronic
1061100260 9:128486789-128486811 CATATGTGAATGAGCAATCATGG + Intronic
1061934339 9:133849162-133849184 CTCATGCCAATGAGCAGGCACGG + Intronic
1186148209 X:6646693-6646715 TTTATGCCAATGAGTGGTGAGGG - Intergenic
1188187631 X:27134528-27134550 CTTATGCTAAAAAGCAATGAGGG - Intergenic
1188672652 X:32898703-32898725 CTTCTGCTAATATGCAATGAGGG + Intronic
1189505490 X:41609455-41609477 CTTAAGCCTATGAGAAATGTGGG - Intronic
1189650889 X:43188357-43188379 CTTATGCTAATGAGCAATGAGGG - Intergenic
1190555428 X:51629386-51629408 CTTATGCTAATGAGTAGTGACGG + Intergenic
1190682446 X:52839261-52839283 CCCATGCTAATAAGCAATGAGGG + Intergenic
1190953297 X:55167309-55167331 CTCATGCTAATAAGCAATAAGGG - Intronic
1190999015 X:55639272-55639294 CATGTGCTAGTGAGCAATGAGGG + Intergenic
1190999098 X:55640968-55640990 CCCATGCTAATAAGCAATGAGGG + Intergenic
1191722892 X:64249242-64249264 CTTATGGGGATGAGCAATGGGGG - Intergenic
1194151944 X:90337178-90337200 CTTATGCTAATGAGCAATGAGGG + Intergenic
1195373941 X:104207161-104207183 ATGGTGCTAATGAGCAATGAGGG + Intergenic
1195389238 X:104343837-104343859 CTTATGTTAATGAACAATGAGGG + Intergenic
1196193984 X:112821285-112821307 CTCATGGCCATGAGTAATGATGG - Intronic
1196813949 X:119650350-119650372 ATTTTGCCAATGAGAAATTAAGG + Intronic
1197221398 X:123917213-123917235 GTAATGGCAATGAGCAATGTGGG - Intergenic
1198167277 X:134070417-134070439 CTTAGGCCTATGACCAAGGAGGG - Intergenic
1198271320 X:135058899-135058921 CTTATGCTGATGGGCAGTGAGGG - Intergenic
1200353530 X:155524716-155524738 CTTCTACCAATAAGCAATAAGGG + Intronic
1200498304 Y:3913944-3913966 CTTATGCTAATGAGCAATGAGGG + Intergenic