ID: 1019954342

View in Genome Browser
Species Human (GRCh38)
Location 7:4401473-4401495
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019954336_1019954342 30 Left 1019954336 7:4401420-4401442 CCTGCAAATTAAGGGGTAGGTCA No data
Right 1019954342 7:4401473-4401495 CTTATGCCAATGAGCAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019954342 Original CRISPR CTTATGCCAATGAGCAATGA GGG Intergenic