ID: 1019958243

View in Genome Browser
Species Human (GRCh38)
Location 7:4434419-4434441
Sequence GATCTCAACAGCTCACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019958243_1019958247 30 Left 1019958243 7:4434419-4434441 CCAGCTGGTGAGCTGTTGAGATC No data
Right 1019958247 7:4434472-4434494 ACGGTCAGAGCCCGCTGCGCCGG No data
1019958243_1019958246 11 Left 1019958243 7:4434419-4434441 CCAGCTGGTGAGCTGTTGAGATC No data
Right 1019958246 7:4434453-4434475 TGAATCGCAGAAGCACAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019958243 Original CRISPR GATCTCAACAGCTCACCAGC TGG (reversed) Intergenic
No off target data available for this crispr