ID: 1019958830

View in Genome Browser
Species Human (GRCh38)
Location 7:4439679-4439701
Sequence CCAGCTCAGTGGTTCTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019958825_1019958830 5 Left 1019958825 7:4439651-4439673 CCGTTAGACAGGTCTCAAGAGGG No data
Right 1019958830 7:4439679-4439701 CCAGCTCAGTGGTTCTCTGTAGG No data
1019958823_1019958830 6 Left 1019958823 7:4439650-4439672 CCCGTTAGACAGGTCTCAAGAGG No data
Right 1019958830 7:4439679-4439701 CCAGCTCAGTGGTTCTCTGTAGG No data
1019958821_1019958830 16 Left 1019958821 7:4439640-4439662 CCGCTGTTTTCCCGTTAGACAGG No data
Right 1019958830 7:4439679-4439701 CCAGCTCAGTGGTTCTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019958830 Original CRISPR CCAGCTCAGTGGTTCTCTGT AGG Intergenic
No off target data available for this crispr