ID: 1019959379

View in Genome Browser
Species Human (GRCh38)
Location 7:4446228-4446250
Sequence TCACCTTGAAAAGAGGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019959379_1019959383 6 Left 1019959379 7:4446228-4446250 CCAGTGCCCTCTTTTCAAGGTGA No data
Right 1019959383 7:4446257-4446279 TTCAATCTCAGCTACCTCTTGGG No data
1019959379_1019959382 5 Left 1019959379 7:4446228-4446250 CCAGTGCCCTCTTTTCAAGGTGA No data
Right 1019959382 7:4446256-4446278 ATTCAATCTCAGCTACCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019959379 Original CRISPR TCACCTTGAAAAGAGGGCAC TGG (reversed) Intergenic
No off target data available for this crispr