ID: 1019959381

View in Genome Browser
Species Human (GRCh38)
Location 7:4446235-4446257
Sequence ATTTTCGTCACCTTGAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019959381_1019959383 -1 Left 1019959381 7:4446235-4446257 CCTCTTTTCAAGGTGACGAAAAT No data
Right 1019959383 7:4446257-4446279 TTCAATCTCAGCTACCTCTTGGG No data
1019959381_1019959382 -2 Left 1019959381 7:4446235-4446257 CCTCTTTTCAAGGTGACGAAAAT No data
Right 1019959382 7:4446256-4446278 ATTCAATCTCAGCTACCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019959381 Original CRISPR ATTTTCGTCACCTTGAAAAG AGG (reversed) Intergenic
No off target data available for this crispr