ID: 1019959382

View in Genome Browser
Species Human (GRCh38)
Location 7:4446256-4446278
Sequence ATTCAATCTCAGCTACCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019959378_1019959382 6 Left 1019959378 7:4446227-4446249 CCCAGTGCCCTCTTTTCAAGGTG No data
Right 1019959382 7:4446256-4446278 ATTCAATCTCAGCTACCTCTTGG No data
1019959379_1019959382 5 Left 1019959379 7:4446228-4446250 CCAGTGCCCTCTTTTCAAGGTGA No data
Right 1019959382 7:4446256-4446278 ATTCAATCTCAGCTACCTCTTGG No data
1019959380_1019959382 -1 Left 1019959380 7:4446234-4446256 CCCTCTTTTCAAGGTGACGAAAA No data
Right 1019959382 7:4446256-4446278 ATTCAATCTCAGCTACCTCTTGG No data
1019959381_1019959382 -2 Left 1019959381 7:4446235-4446257 CCTCTTTTCAAGGTGACGAAAAT No data
Right 1019959382 7:4446256-4446278 ATTCAATCTCAGCTACCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019959382 Original CRISPR ATTCAATCTCAGCTACCTCT TGG Intergenic
No off target data available for this crispr