ID: 1019960217

View in Genome Browser
Species Human (GRCh38)
Location 7:4452808-4452830
Sequence GTGCCAATTGTCACAGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019960217_1019960220 -2 Left 1019960217 7:4452808-4452830 CCCAAAGCTGTGACAATTGGCAC No data
Right 1019960220 7:4452829-4452851 ACGGATCCATACACCTAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019960217 Original CRISPR GTGCCAATTGTCACAGCTTT GGG (reversed) Intergenic
No off target data available for this crispr