ID: 1019960218

View in Genome Browser
Species Human (GRCh38)
Location 7:4452809-4452831
Sequence CGTGCCAATTGTCACAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019960218_1019960220 -3 Left 1019960218 7:4452809-4452831 CCAAAGCTGTGACAATTGGCACG No data
Right 1019960220 7:4452829-4452851 ACGGATCCATACACCTAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019960218 Original CRISPR CGTGCCAATTGTCACAGCTT TGG (reversed) Intergenic
No off target data available for this crispr