ID: 1019968688

View in Genome Browser
Species Human (GRCh38)
Location 7:4522765-4522787
Sequence CATCTGTGGGAGACCTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019968680_1019968688 25 Left 1019968680 7:4522717-4522739 CCAACACAAGCTGTGCAAACAGC No data
Right 1019968688 7:4522765-4522787 CATCTGTGGGAGACCTTGGTTGG No data
1019968682_1019968688 -7 Left 1019968682 7:4522749-4522771 CCTCTGCCAACACCAGCATCTGT No data
Right 1019968688 7:4522765-4522787 CATCTGTGGGAGACCTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019968688 Original CRISPR CATCTGTGGGAGACCTTGGT TGG Intergenic
No off target data available for this crispr