ID: 1019971847

View in Genome Browser
Species Human (GRCh38)
Location 7:4547843-4547865
Sequence TGCCGTGTGTTCACTGCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019971847_1019971851 18 Left 1019971847 7:4547843-4547865 CCCCTAGCAGTGAACACACGGCA No data
Right 1019971851 7:4547884-4547906 CCCCATCTCCGTCACCAGCATGG No data
1019971847_1019971853 19 Left 1019971847 7:4547843-4547865 CCCCTAGCAGTGAACACACGGCA No data
Right 1019971853 7:4547885-4547907 CCCATCTCCGTCACCAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019971847 Original CRISPR TGCCGTGTGTTCACTGCTAG GGG (reversed) Intergenic
No off target data available for this crispr