ID: 1019972703

View in Genome Browser
Species Human (GRCh38)
Location 7:4554365-4554387
Sequence AGTGCTTTGCACACTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019972703_1019972706 4 Left 1019972703 7:4554365-4554387 CCCTCCACAGTGTGCAAAGCACT No data
Right 1019972706 7:4554392-4554414 ATGTGCTTTATGTCATATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019972703 Original CRISPR AGTGCTTTGCACACTGTGGA GGG (reversed) Intergenic
No off target data available for this crispr